Non targeting shrna

Lentiviral vectors expressing two distinct shRNAs against human SATB2 (Cat # TRCN0000020685 or TRCN0000020688), human CBP (Cat # TRCN0000356053), and non‐targeting shRNA (Cat # SHC002) were obtained from Sigma‐Aldrich. A lentiviral construct expressing FOXM1 was generated by cloning the human FOXM1 open reading frame into the pCDH‐EF1‐MCs‐IRES‐Neo vector (System Biosciences, Cat # CD533A‐2). The lentivirus packaging and transduction performed as previously described (Fang et al, 2017).

Human melanoma cell lines (A375, C32, HT144, MeWo, SKmel28, SKmel23, SKmel30, SKmel103, SKmel147, SKmel173, WM266-4) were cultured in DMEM (Gibco, Life Technologies) with 10% FBS (Biochrom), 0.1mM β-mercapthoethanol (Gibco, Life Technologies), 1% non-essential amino acids (NEAA) and 1% Penicilin/Streptomycin (Sigma-aldrich). Normal human melanocytes (NHM) were isolated from donor foreskins according to the ethical regulation (Ethics committee II, University Medical Center Manheim, Germany) and were cultivated in medium 254 (Gibco, Life Technologies) supplemented with 100x human melanocyte growth supplement (HMGS) (Gibco, Life Technologies). Human neural crest cells were derived from hiPSC following a previously published protocol [23 (link)]. All cell lines were cultured in humidified incubator at 37°C and 5% CO2. Cell lines were sub-cultured every 3–5 days when they were 80% confluent.
A375, HT144 and SKmel28 cell lines were transduced with a lentiviral expression vector (pLKO.1) encoding for a human ID3 shRNA or a non-targeting shRNA (Sigma-Aldrich). WM266-4 cell line was transduced with either an empty lentiviral vector (pLX304) or the vector encoding for human ID3 (Addgene).

Non-targeting shRNA and anti-mNcan shRNA were purchased from Sigma. The plasmid encoding either shRNA or NCAN was cotransfected with the lentivirus packaging plasmids pMD2.G (plasmid 12259, Addgene, Cambridge, MA) and psPAX2 (plasmid 12260, Addgene) into HEK293T cells. The titer of virus was determined with the use of a QuickTiter Lentivirus Titer kit (CellBiolabs, San Diego, CA). The shRNA sequences were as follows.
Mouse NCAN shRNA#59: 5′-ccggctagtaatgtgacgatgaatcctcgaggattcatcgtcacattactagtttttg-3′
Mouse NCAN shRNA#60: 5′-ccggtatgcagcccttgcgagaatgctcgagcattctcgcaagggctgcatatttttg-3′
Mouse NCAN shRNA#61: 5′-ccggcaggcgtcgtgttccattatcctcgaggataatggaacacgacgcctgtttttg-3′
Human NCAN shRNA#55: 5′-ccgggagaaccagccggacaatttcctcgaggaaattgtccggctggttctcttttttg-3′
Human NCAN shRNA#58: 5′- ccgggccaatagagttgaggcacatctcgagatgtgcctcaactctattggctttttg-3′