Anti pr antibodies
Anti-PR antibodies are laboratory reagents that specifically bind to and detect the progesterone receptor (PR) protein. They are used to study the expression and localization of PR in cells and tissues.
2 protocols using anti pr antibodies
Chromatin Immunoprecipitation Protocol
Chromatin Immunoprecipitation of ER-α and PR
PR Bindsite: Sense primer 5′–AGGCTGAGGAGGCACTTTGT–3′, Anti-sense primer 5′–AGTGGGCATTTTCGGGTG–3′.
ER-a Bindsite1: Sense primer 5′–CCCTTCCGAATCCTTCCAGTG–3′, Anti-sense primer 5′–TCGCCTGGTGGGGGAGA–3′;
Bindsite2: Sense primer 5′–CTCTGCCGTCCGCTACACC–3′, Anti-sense primer 5′–GGAAGGAGAAAGGAAGGGAGG–3′;
Bindsite3: Sense primer 5′–CGCCCTCGCTCGCTCCTT–3′, Anti-sense primer 5′–GCCCCCCGCAAGCCAA–3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!