Chromatin immunoprecipitation assays were performed using a Pierce™ Magnetic ChIP Kit (Thermo Scientific™). Immunoprecipitation was performed with anti-ER-α, anti-ERBB2, and anti-PR antibodies (Cell Signaling Technology). Specific regions were quantified via qRT-PCR using the primers listed in Table S13 .
Anti pr antibodies
Manufactured by Cell Signaling Technology
Anti-PR antibodies are laboratory reagents that specifically bind to and detect the progesterone receptor (PR) protein. They are used to study the expression and localization of PR in cells and tissues.
Automatically generated - may contain errors
2 protocols using anti pr antibodies
1
Chromatin Immunoprecipitation Protocol
2
Chromatin Immunoprecipitation of ER-α and PR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assays were performed with SimpleChIP® Plus Enzymatic Chromatin IP Kit (Cell Signaling Technology). Immunoprecipitation was performed with anti-ER-a (#8644, Cell Signaling Technology) and anti-PR antibodies (#8757, Cell Signaling Technology). Specific regions were quantified via qRT-PCR using the primers:
PR Bindsite: Sense primer 5′–AGGCTGAGGAGGCACTTTGT–3′, Anti-sense primer 5′–AGTGGGCATTTTCGGGTG–3′.
ER-a Bindsite1: Sense primer 5′–CCCTTCCGAATCCTTCCAGTG–3′, Anti-sense primer 5′–TCGCCTGGTGGGGGAGA–3′;
Bindsite2: Sense primer 5′–CTCTGCCGTCCGCTACACC–3′, Anti-sense primer 5′–GGAAGGAGAAAGGAAGGGAGG–3′;
Bindsite3: Sense primer 5′–CGCCCTCGCTCGCTCCTT–3′, Anti-sense primer 5′–GCCCCCCGCAAGCCAA–3′.
PR Bindsite: Sense primer 5′–AGGCTGAGGAGGCACTTTGT–3′, Anti-sense primer 5′–AGTGGGCATTTTCGGGTG–3′.
ER-a Bindsite1: Sense primer 5′–CCCTTCCGAATCCTTCCAGTG–3′, Anti-sense primer 5′–TCGCCTGGTGGGGGAGA–3′;
Bindsite2: Sense primer 5′–CTCTGCCGTCCGCTACACC–3′, Anti-sense primer 5′–GGAAGGAGAAAGGAAGGGAGG–3′;
Bindsite3: Sense primer 5′–CGCCCTCGCTCGCTCCTT–3′, Anti-sense primer 5′–GCCCCCCGCAAGCCAA–3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!