Recombinant protein g

All of the reagents used in this study were of analytical grade. Tris-EDTA (TE) pH 8.0, phosphate buffered saline (PBS) pH 7.2, bovine serum albumin (BSA), sodium chloride (NaCl), potassium ferricyanide (K ${}_3$ [Fe(CN) ${}_6$ ]), potassium chloride (KCl) and ammonium hydroxide solution 28% (NH ${}_3$ (aq)) were purchased from Sigma-Aldrich (UK). Recombinant protein G was obtained from ThermoFisher (UK). PBS tablets, pH 7.4, were purchased from Fisher Scientific (UK), and the PBS buffer solution was prepared in Milli-Q water. Mouse anti-5-methylcytosine monoclonal antibody (anti-5mC) was purchased from Zymo research (USA). All the synthetic nucleic acids were obtained from Integrated DNA Technologies (USA). The purchased single-stranded (ss) DNA sequence of the MGMT oligonucleotide was GTCC $C_M$ GA $C_M$ GCC $C_M$ GCAG GTCCT $C_M$ GCGGTGCGCACCGTTTGCGACTTGGTG, where $C_M$ was methylcytosine. The complementary sequence was CACCAAGTCGCAAACGGTGCGCACCGCGAGGACCTGCGGGCGTCGGGAC.

Bioflex culture plates (untreated, Flexcell Int.) were coated with 2.2 µg/cm² of bovine fibronectin (Thermo Fisher Scientific) on 4 cm² of the center of the wells for 1 h at 37°C. The wells were treated with 1% Pluronic F-127 (Sigma-Aldrich) for 5 min at room temperature to prevent aspecific adhesions. For the induction of Notch signaling, 50 μg/ml Recombinant Protein G (Thermo Fisher Scientific) in PBS were added to the fibronectin-coated membranes and incubated overnight at room temperature. Plates were incubated with 2 μg/ml of Recombinant Human Jagged1-Fc Chimera Protein (R and D Systems) in 0.1% bovine serum albumin (BSA)/PBS for 3 h at room temperature. Cells were immediately seeded on Bioflex culture plates with densities of 100.000 cells/4 cm² for synthetic VSMCs and 150.000 cells/4 cm² for contractile VSMCs and left to attach overnight. Notch inhibition was performed by adding 10 μg/ml γ-secretase inhibitor DAPT (Sigma- Aldrich) to the culture media from stock solutions in sterile dimethyl sulfoxide (DMSO) (Sigma-Aldrich). The same concentration of the vehicle DMSO was added to the other samples for comparison. DMSO/DAPT was refreshed every 24 h.

Glass fiber sample pad strips (Millipore GFCP103000, Burlington, MA, USA), glass fiber conjugate pad strips (Millipore GFDX083000), Whatman^® FF170HP sheets nitrocellulose membrane, cellulose fiber absorbent pad sheets (Millipore CFSP223000), C-reactive protein from human fluids (CRP), and peroxidase from horseradish (HRP) were purchased from Merk Life Science S.r.l. (Milan, Italy). Anti-CRP polyclonal goat IgG antibody Horse Radish Peroxidase conjugated (ThermoFisher Scientific, Waltham, MA, USA), a-CRP-HRP in the following, was used for conjugation to 40 nm gold nanoprticles (gNPs; Gold Conjugation Kit (40 nm, 20 OD); abcam, Cambridge, UK). Anti-CRP mouse monoclonal antibody (abcam) and recombinant Protein G (ThermoFisher Scientific) were spotted on nitrocellulose as test line (TL) and control line (CL), respectively. The developer solutions were: SuperSignal™ELISA Femto Substrate from ThermoFisher Scientific, Westar SuperNova from Cyanagen S.R.L. Bologna, Italy and Westar HyperNova also from Cyanagen S.R.L. Bologna, Italy.

Single-molecule constructs (see Fig. 1a,b) were made as described previously37 (link)48 (link), using the recombinant pSFCASS5 plasmids containing the pseudoknot sequences19 (link). The ~1160-nt RNA molecules were made by PCR amplification of the plasmids followed by in vitro transcription by T3 RNA polymerase (Promega). The RNAs contain a 475-nt upstream sequence, a 2-nt single-stranded linker (GA), the pseudoknot sequences, a downstream 2-nt single-stranded linker (AU), and a 630-nt downstream sequence. The RNAs were annealed with complementary strands of PCR-generated 475-bp and 630-bp double-stranded DNAs (dsDNAs) to generate RNA/DNA hybrid handles (handle A and handle B). T4 DNA polymerase (NEB) was used to label the 3′ end of the DNA strand of handle A by introducing biotin-16-dUTP (Roche). Handle B was labeled at the 5′ end of the DNA strand by digoxigenin labeled primer during PCR. 1.8-μm Streptavidin coated polystyrene beads were purchased from Spherotech. Recombinant protein G (Thermo Scientific) was coated on 3-μm carboxyl coated polystyrene beads (Spherotech) using EDC (Sigma) and sulfo-NHS (Thermo Scientific). Dimethyl pimelimidate (Thermo Scientific) was used to cross-link anti-digoxigenin antibody to the protein G-coated beads. Only appropriately annealed DNA/RNA hybrids are able to form a tether with both types of beads.