Rneasy plus tissue mini kit

RNA was extracted from the patient's spleen sample and a matching sample from another unaffected Boston Terrier’using RNeasy Plus Tissue Mini Kit (Qiagen, Valencia, CA, USA). cDNA was prepared using QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). The RT PCR reaction was performed using IDUA primers designed on Primer3 while RPS5 primers were designed as recommended by Brinkhof et al. (Table 1)^{64 (link),65 (link)}. Each reaction included 14.3 μl water, 2 μl 5x Buffer with MgCl₂, 1 μl dNTP (20 mM), 0.8 μl of each forward and reverse primers (20 μM), 0.1 μl of HotStarTaq. DNA Polymerase (Qiagen, Valenica, CA, USA), and 1 μl of cDNA made from1000 ng of RNA. Amplified products were visualized on a 2% agarose gelTable 1

Primers used for semi-qPCR.

	Forward Primer (5’→3’)	Reverse Primer (5’→3’)
IDUA	AGCTCAACCTGGCCTATGTG	TCAGAGCAGGCGTCGTAGTA
RPS5	TCACTGGTGAGAACCCCCT	CCTGATTCACACGGCGTAG

These experiments were performed as we previously described^{21 (link)–23 (link)}. For Western blot, antibodies for GAPDH (sc-32233; Santa Cruz Biotechnology, Santa Cruz, CA, USA), Cosmc (sc-67480; Santa Cruz Biotechnology), CEL (ab79131; Abcam, Cambridge, UK; sc-34883; Santa Cruz Biotechnology), DMBT1 (MAB59151; R&D Systems, Minneapolis, MN, USA), elastase (ab21593; Abcam) and trypsin (ab166898; Abcam) were used. Ten micrograms per milliliter of Vicia villosa lectin (VVA) reactive against O-GalNAc (Tn antigen) (B-1235; Vector Laboratories, Burlingame, CA, USA) complexed with 1 µg streptavidin-HRP (21126; Pierce, Thermo Fisher Scientific, Grand Island, NY, USA) was used. For immunohistochemistry, antibodies for Tn Antigen (MA180055; Thermo Fisher Scientific, Grand Island, NY, USA), STn Antigen (ab115957; Abcam), insulin (8138; CST, Beverly, MA, USA) and VVA-fluorescein (FL-1231; Vector Laboratories) were used at a dilution of 1:100^{23 (link)}. Ten micrograms per milliliter of Sambucus nigra lectin (SNA) (B- 1305–2; Vector Laboratories, Burlingame, CA, USA) was complexed with 1 µg streptavidin-HRP. For real-time PCR, RNA was extracted with the RNeasy Plus Tissue Mini Kit (Qiagen).