Genome information for zebrafish was obtained from National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/ ) for cxcr1 (XM_001337602.5), cxcr2 (XM_001337057.4), and cxcl8a (XM_001342570.6). Left arms and right arms of TALEN that target the were designed using online tools (TAL Effector Nucleotide Targeter version 2.0, https://tale-nt.cac.cornell.edu/ ) as previously reported (Cermak et al., 2011 (link); Doyle et al., 2012 (link)). The expression plasmids of the TALEN were constructed using the “unit assembly” method (Huang et al., 2011 ). The plasmids for synthesizing TALENs were linearized by NotI digestion and mRNAs were transcribed in vitro using the mMESSAGE mMACHINE SP6 kit (Life Technologies). The synthesized mRNAs were dissolved in DEPC treated water (TAKARA), and 0.5% phenol red. The final concentration was about 400 ng/μL. Embryos were injected together with forward and reverse TALEN mRNAs (400 pg) at the one-cell stage.
Depc treated water
Manufactured by Takara Bio
Sourced in China
DEPC treated water is a laboratory reagent used to inactivate RNase enzymes, which can degrade RNA samples. It is prepared by treating water with diethyl pyrocarbonate (DEPC), a chemical agent that inhibits RNase activity. This water is commonly used in RNA-based experiments and applications where maintaining the integrity of RNA is critical.
Automatically generated - may contain errors
Lab products found in correlation
Mmessage mmachine sp6 kit, by Thermo Fisher Scientific (1 mentions)
Span 80, by Merck Group (1 mentions)
Calcein am, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Mineral oil, by Merck Group (1 mentions)
Taqman microrna rt kit, by Thermo Fisher Scientific (1 mentions)
2 protocols using depc treated water
1
TALEN Knockout for Zebrafish Chemokine Genes
2
Quantitative Analysis of miR-122 using TaqMan Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All solvents and chemicals were used as received unless stated otherwise. TaqMan microRNA RT kit (No. 4366596), TaqMan universal PCR master mix (AmpErase UNG, No. 4324018) and primers (No. 4395356) were purchased from Applied Biosystems (Orbital Instrument Co., Shanghai, China). The sequence of mature mir-122 (UGGAGUGUGACAAUGGUGUUUG) selected from the Sanger Center miRBase at http://microrna.sanger.ac.uk/sequences and synthetic mature mir-122 oligonucleotides were synthesized by GenePharma (Shanghai, China). DEPC-treated water (TaKaRa, Dalian, China) was used throughout to prepare the PCR samples and reagents. RNase Remover (TianDZ Gene Tech. Beijing, China), prepared in water or ethanol (2%, v/v), was used to wash microchips and capillaries. Mineral oil, Span 80, bovine serum albumin (BSA) and octadecyltrichlorosilane (OTCS) were products of Sigma-Aldrich (St. Louis, USA). Huh-7 cells purchased from CCTCC (Wuhan, China) were cultured in DMEM containing 10% FBS (Gibco, Life Technologies, Carlsbad, USA). Calcein-AM, purchased from Invitrogen (Life Technologies, Carlsbad, USA), was used to fluorescent staining and counting of viable cells in droplets.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!