The largest database of trusted experimental protocols
Sourced in United States

SiHa cells are a cervical cancer cell line derived from a 55-year-old female patient. They are adherent epithelial cells that express the human papillomavirus (HPV) type 16 E6 and E7 oncoproteins.

Automatically generated - may contain errors

21 protocols using siha cells

1

Culturing SiHa and ccd986sk Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiHa cells (human cervical cancer cells) were purchased from ATCC, and ccd986sk cells (human dermal fibroblast cells) were obtained from the Korean Cell Line Bank. SiHa cells and ccd986sk cells were cultured as a monolayer in DMEM and IMDM, respectively, supplemented with 10% FBS and 1% penicillin, in a humidified incubator with 5% CO2 at 37℃. The medium was changed every 2 days.
+ Open protocol
+ Expand
2

Culturing Human Cervical Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiHa cells (ATCC; Manassas, VA, USA), a human cervical squamous cell carcinoma cell line, were cultured in RPMI-1640 plus 10% calf serum and 1% penicillin/streptomycin in a 5% CO2 humidified incubator at 37°C.
+ Open protocol
+ Expand
3

Manipulating NRF2 in Cervical Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiHa cells (ATCC; Manassas, VA, USA), a human cervical squamous cell carcinoma cell line, were cultured in RPMI 1640 plus 10% calf serum and 1% penicillin/streptomycin in a 5% CO2 humidified incubator at 37°C. SiHa cells were seeded in six-well plates and grown to 60%-80% confluence. NRF2 in the eukaryotic expression vector pcDNA3.1 (5- TCCGCTCGAGATGA TGGACTTGGAGCTGCC-3, antisense 5- ATGGGGTACCGAGTTTTTCTTAACATCTGGC-3), NRF2 inhibitor (10620318–267435 A03 / 10620318–267435 A05), and the scrambled sequence (CCAACCAGUUGACAGUGAACUCAUU / CAAACUGACAGAAGUUGACAA UUAU) were synthesized by Invitrogen (SHANGHAI, CN). Transfection complexes were formed with Lipofectamine RNAiMAX (Invitrogen, CA, USA) in Opti-MEMI (Invitrogen, CA, USA) according to manufacturer guidelines. Negative controls were cultured in normal conditions. All transfections were performed in triplicate. Cell proliferation was determined by counting cells 24, 48, and 72 hours (h) after transfection. RNA and protein were extracted 48 h or 72 h, respectively, after transfection.
+ Open protocol
+ Expand
4

Culturing Cervical Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cervical cancer cells (HeLa, ME-180, and SiHa cells) were purchased from ATCC (Manassas, USA), and cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS, Invitrogen, USA) and 1% penicillin/streptomycin (Gibco/Invitrogen) at 37°C in a 5% CO2 atmosphere in an incubator. Normal cervical epithelial cells were obtained from ATCC, and maintained in DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37°C.
+ Open protocol
+ Expand
5

Cell Line Cultivation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell lines used in this study were derived from a variety of carcinoma types. HeLa cells (HPV18-positive cervical epithelial adenocarcinoma), FaDu cells (HPV-negative hypopharyngeal carcinoma), Detroit 562 cells (HPV-negative pharyngeal carcinoma), CaSki cells (HPV16-positive cervical squamous cell carcinoma), and SiHa cells (HPV16-positive cervical squamous cell carcinoma) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). MCF-7 cells (HPV-negative breast carcinoma) were kindly provided by Dr. Libor Macurek (Institute of Molecular Genetics, Czech Republic).
HeLa, CaSki, and SiHa cells were cultured in Roswell Park Memorial Institute 1640 (RPMI-1640) medium (Sigma‒Aldrich, St. Louis, MO, USA); FaDu and Detroit 562 cells in Eagle's minimum essential medium (EMEM; Sigma‒Aldrich); and MCF-7 cells in Dulbecco's modified Eagle's medium (DMEM; Sigma‒Aldrich). All cell culture media were supplemented with 10% fetal bovine serum (FBS; Sigma‒Aldrich), 100 IU/mL penicillin, and 100 μg/mL streptomycin (Biosera, Kansas, MO, USA). The cells were cultured in an incubator at 37°C in 5% CO2 and periodically checked for mycoplasma contamination. The cells were harvested at 80% confluency using a 0.05% trypsin-EDTA solution in phosphate-buffered saline (PBS) for further examination.
+ Open protocol
+ Expand
6

SiHa Cell Viability Assay with Crocin

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiHa cells were purchased from the American Type Culture Collection (Rockville, MD, USA), and were maintained at 37 °C with 5% CO2. Cells were cultured with Dulbecco’s modified eagle medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution. For testing cell viability, the SiHa cells were seeded onto 96-well plates with 3×103 cells/well in 100 µL of DMEM medium supplemented with 0.06, 0.13, 0.25, 0.5, 1, 2, 4, 8 and 16 mM of crocin (#17304, Sigma-Aldrich, Missouri, USA). After 22 hours, 10 µL CCK-8 solution was dissolved in 90 µL of DMEM medium and subsequently added to each well. The plates were incubated for 2 hours, and the absorbance value was measured at 450 nm.
+ Open protocol
+ Expand
7

Siva 1 Overexpression in Cervical Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human cervical cancer cells, C33A cells, Hela cells and Siha cells were purchased from the American Type Culture Collection (ATCC; Manassas, VA) and maintained in DMEM supplemented with 10% fetal bovine serum (FBS; Hyclone; GE Healthcare; Logan, UT, USA) at 37°C in 5% CO2. Siva 1 overexpression plasmid pCMV3-Siva 1 was designed by China National Pharmaceutical Group Co., Ltd. C33A cells transfected with plasmids using lipofectamine reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Two hundred micrograms per milliliter G418 (Invitrogen; Thermo Fisher Scientific, Inc.) was contained in the medium during the whole process of cell culture. The transfection efficiency was determined by both Western blot and RT-qPCR. Then, the stable over-expressing Siva 1 C33A cells were established for subsequent experiments.
+ Open protocol
+ Expand
8

Culturing and Transfecting Cervical Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cervical cancer SiHa cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and maintained in an incubator using an RPMI-1640 medium supplemented with 10% fetal bovine serum (Hyclone) at 37°C with 5% CO2. Stable HeLa cells were also maintained using Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Hyclone) in an incubator at 37°C with 5% CO2. The cells were transfected with siRNA using the Lipofectamine 2000 transfection reagent (Invitrogen, USA) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
9

Silencing ADAR1 in HPV Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HeLa cell lines were obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank. SiHa cells were obtained from the American Type Culture Collection (ATCC). The HPV16-type SiHa, HPV18-type HeLa, and non-HPV-type Yumoto cell lines were maintained in Dulbecco’s Modified Eagle’s Medium (Life Technologies, CA, USA), supplemented with 10% fetal bovine serum. Cell lines were maintained in a humidified incubator containing 5% CO2 at 37 °C. Cells were used for functional experiments within 3 months of passaging post-receipt. The SiHa, HeLa, and Yumoto cell lines were trypsinized and plated in culture dishes. At ~ 50% confluency, the cell lines were transfected with an annealed ADAR1 siRNA (siADAR1, sc-37657; Santa Cruz Biotechnology, TX, USA), control siRNA (siControl, sc-37007; Santa Cruz Biotechnology, TX, USA), or an empty vector (mock) for gene silencing (final concentration, 100 nmol/L) using an siRNA transfection reagent (sc-29528; Santa Cruz Biotechnology, TX, USA).
+ Open protocol
+ Expand
10

HPV-Transformed Cervical Cancer Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human cervical cancer cells transformed with HPV16 (SiHa cells), and HPV18 (HeLa cells) were obtained from the American Type Culture Collection (ATCC). The cell line was cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA) supplemented with 10 % fetal bovine serum (FBS), penicillin/streptomycin (50 μg/ml), 2 mM L-glutamine, 250 ng/ml fungizone, and maintained at 37 °C in 5 % CO2. The total RNA isolation was carried out with TriPure isolation reagent (Roche, Indianapolis, IN) for the end-point RT-PCR and real time RT-qPCR assays. The cellular protein isolation was performed and protein concentration was determined by the BCA protein kit (Pierce, Rockford, IL.) for the Western Blot assays. The cells were attached on a slide for epifluorescence microscopy assays or fixed in ethanol for the flow cytometry assays. In addition, the cells which were used in transfection assays were analyzed for the luciferase activity assays.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!