The largest database of trusted experimental protocols
Sourced in United States

The CEM-SS is a laboratory equipment product offered by American Type Culture Collection. It is a high-performance, precise, and reliable device used for controlled atmospheric incubation of cell cultures. The CEM-SS provides a stable and optimal environment for the growth and maintenance of various cell lines.

Automatically generated - may contain errors

5 protocols using cem ss

1

Cell Lines, Reagents, and Viral Vectors for Biological Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T, Jurkat, KG-1, Cem-A, Molt and Cem-SS cells were obtained from the American Type Culture Collection (ATCC). 293T cells were maintained in Dulbecco’s Modified Eagle Medium (Cellgro) supplemented with 10% Fetal Bovine Serum, FBS (Gemini Bioproducts). Rest of the cells were maintained in Iscove's Modified Dulbecco's Medium (ATCC) supplemented with 20% FBS.
The following reagents were obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH; p24 Monoclonal Antibody (183-H12-5C) from Dr. Bruce Chesebro and Kathy Wehrly, pSV-Ψ-MLV-env- from Dr. Nathaniel Landau.
Goat-anti-mouse-horseradish peroxidase and goat-anti-rabbit-horseradish peroxidase (HRP) secondary antibodies and West Femto enhanced chemiluminescent (ECL) HRP substrate were obtained from Thermo Scientific (Rockford, IL). Rabbit polyclonal Antibody against gp96 was obtained from GeneTex (Irvine, CA). Mouse monoclonal antibody against GAPDH was obtained from ABM (Richmond, BC, Canada). VSVG mouse monoclonal antibody was obtained from KeraFAST. DiI-LDL was obtained from Kalen Biochemical (Montgomery Village, MD) VSV-eGFP was a kind gift from Dr. Asit Pattnaik (University of Nebraska-Lincoln). Measles-GFP was a kind gift from Dr. Stephen Russell (Mayo Clinic, Rochester).
+ Open protocol
+ Expand
2

Cultivation of CEM-SS Leukemia Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
The T-lymphoblastic leukaemia cell line, CEM-SS, (anchorage-dependent and suspension cells) were obtained from the American Type Culture Collection (ATCC), the National Cancer Institute (NCI) and the RIKEN Cell Bank (RCB).
+ Open protocol
+ Expand
3

Primary T Cell HIV Infection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
CEM-SS and Jurkat cells were obtained from the American Type Culture Collection (ATCC). Primary CD4+ T cells were isolated as previously described (21 (link)). Primary CD4+ T cells were infected with 100 ng of WT NL4-3 or mutant viruses. Approximately 16 h later, the cells were washed and treated with dimethyl sulfoxide (DMSO) or 100 nM didehydro-cortistatin A (dCA) for 6 days. Supernatants were collected, and p24 was measured by ELISA (catalog no. 5447; Advanced BioScience Laboratories, Inc.). To obtain chronically infected Jurkat populations, cells were infected at a multiplicity of infection of 0.5 for 12 h. Cells were washed three times. Fresh culture medium was then added, and the cells were passaged twice a week for 3 months. CEM-SS and Jurkat cells cultured in Roswell Park Memorial Institute 1640 (RPMI 1640) medium with 10% fetal bovine serum (FBS) and PSG (penicillin [100 U/ml], streptomycin [100 g/ml], and l-glutamine [2 mM]). HeLa-CD4 (HT4-6C) cells were obtained from the NIH AIDS Reagent Program. Stable HeLa-CD4 LTR-Luc cells were obtained by transfecting HeLa-CD4 cells with pGL4.22_WT LTR-Luc, pGL4.22_MUT1 LTR-Luc, and pGL4.22_MUT2 LTR-Luc and selected with puromycin (2 μg/ml). HeLa-CD4 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 5% FBS and PSG. All cells were cultured at 37°C and 5% CO2.
+ Open protocol
+ Expand
4

Generating Pseudotyped HIV Viruses

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T, TZM-bl, and CEM-SS cell lines were obtained from the American Type Culture Collection. HEK293T and TZM-bl cell lines were maintained in Dulbecco's modified Eagle's medium and CEM-SS cell line was maintained in RPMI 1640 medium (Corning Cellgro). Both media were supplemented to contain 10% fetal calf serum (Hyclone), 100 IU/ml penicillin and 100 μg/ml streptomycin (GIBCO).
A3G-P210R mutant was generated by site-directed mutagenesis (QuickChange Lightening site-directed mutagenesis kit, Agilent Technologies) using the following primers: P210R_sense: 5’ATTCACTTTCAACTTTAACAATGAACGGTGGGTCAGAGGAC3’ P210R_antisense: 5’GTCCTCTGACCCACCGTTCATTGTTAAAGTTGAAAGTGAAT3’.
All viruses were prepared using a previously described HIV-1 vector pHDV-eGFP pseudotyped by co-transfecting with phCMV-G plasmid, which expresses vesicular stomatitis virus glycoprotein (VSV-G) [42 (link), 53 (link)–58 (link)]. Briefly, we co-transfected pHDV-eGFP (1.0 μg), pHCMV-G (0.25 μg), and either 0.34 μg or 0.67 μg of pFlag-WT-A3G or pFlag-P210R-A3G expression plasmids in the presence or absence of pcDNA-hVif using polyethylenimine (PEI) as previously described [42 (link), 53 (link)–55 (link)]. Virus-containing supernatant was clarified by filtering through a 0.45-μm filter and kept at -80°C until use.
+ Open protocol
+ Expand
5

Culturing Common Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human leukemia cell line (CEM-ss), breast cancer cell line (MDA-MB-231), cervical cancer cell line (HeLa), liver cancer cell line (HepG2), and normal human mammary epithelial cell line (MCF-10A) were purchased from American Type Culture Collection (ATCC) (Maryland, MD, USA). The cells were maintained in RPMI-1640 (ATCC) medium supplemented with 10% heat inactivated fetal bovine serum (FBS) (ATCC), and a 1% mixture of penicillin/streptomycin and amphotericin B (Sigma-Aldrich). All other used chemical and reagents were high grade.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!