Chemical reagents, including nuclease-free water and DNase I amplification kit, were purchased from Sigma Aldrich, Gillingham, UK, and Fisher Scientific, Loughborough, UK. Pre-designed siRNA, Opti-MEM, Power SYBR Green, and the high-capacity RNA to cDNA kit were purchased from Life Technologies, Inchinnan, UK. PolyPlus Interferin and Lipofectamine 2000 reagents were purchased from PolyPlus-Sartorius, Epsom, UK. LAL reagent water, Dulbecco’s Modified Eagle Medium (DMEM), L-Glutamine, and Foetal Bovine Serum (FBS) were purchased from Lonza, Slough, UK. Smooth LPS—E. coli O111:B4—was purchased from Sigma-Aldrich. Semi-rough (Rc) LPS—E. coli J5 and Rough (Re) LPS—E. coli K12 D32m4—was purchased from List Biological Laboratories, Eastbourne, UK.
Pre designed sirna
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
Pre-designed siRNA is a type of laboratory equipment used for gene silencing studies. It consists of short, double-stranded RNA molecules that target specific messenger RNA (mRNA) sequences, leading to the degradation or translational repression of the targeted mRNA. This tool allows researchers to investigate the functions of individual genes in cellular and biological processes.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (4 mentions)
Power sybr green, by Thermo Fisher Scientific (3 mentions)
Opti mem, by Thermo Fisher Scientific (3 mentions)
Protein ladders, by Santa Cruz Biotechnology (2 mentions)
Bca assay kit, by Merck Group (2 mentions)
Polyplus interferin, by Source Bioscience (2 mentions)
Protein a g agarose gel beads, by Santa Cruz Biotechnology (2 mentions)
Rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Dmem culture medium, by Lonza (2 mentions)
Nuclease free water, by Merck Group (1 mentions)
Lal reagent water, by Lonza (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
L glutamine, by Lonza (1 mentions)
Foetal bovine serum (fbs), by Lonza (1 mentions)
Dulbecco s modified eagle medium dmem, by Lonza (1 mentions)
Ncbi blast, by Eurofins (1 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions)
8 protocols using pre designed sirna
1
Lipopolysaccharide Preparation and Transfection
2
Biochemical Assays and Cell Culture Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemical reagents for preparing buffers and the BCA Assay Kit were purchased from Sigma Aldrich, U.K. and Fisher Scientific, U.K. Buffers used include RIPA buffer, phosphate-buffered saline (PBS), Tris-buffered saline (TBS), blocking buffer, cell lysis buffer, elution buffer, SDS sample buffer, and ECL detection reagent [23 ]. PolyPlus INTERFERin was purchased from Source Bioscience, U.K. Pre-designed siRNA, Opti-MEM, Power SYBR Green, RNA to cDNA kit, and gel casting materials were purchased from Life Technologies, U.K. Antibodies, Protein A/G agarose gel beads, and protein ladders were obtained from Santa Cruz Biotechnology, UK and Cell Signalling Technologies, U.K. Recombinant mouse proteins, ELISA antibodies and detection reagents were purchased from Peprotech Ltd. DMEM culture medium and other cell culture materials were purchased from Lonza, U.K. PCR primers were designed with Primer3 Plus Bioinformatics Software and NCBI BLAST and purchased from Eurofins Genomics.
3
Protein expression and gene silencing protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemicals reagents used to prepare buffers and BCA Assay kit were purchased from Sigma Aldrich, UK and Fisher Scientific, UK. Buffers used include RIPA buffer, Phosphate-buffered saline (PBS), Tris-buffered saline (TBS), Blocking Buffer, Cell lysis buffer, elution buffer, SDS sample buffer, and ECL detection reagent [23] . PolyPlus INTERFERin was purchased from Source Bioscience, UK. Pre-designed siRNA, Opti-MEM, Power SYBR Green, RNa to cDNA kit, and gel casting materials were purchased from Life Technologies, UK.
Antibodies, Protein A/G agarose gel beads, and protein ladders were obtained from Santa Cruz Biotechnology, UK and Cell Signalling Technologies, UK. DMEM culture medium and other cell culture materials were purchased from Lonza, UK. PCR primers were designed with Primer3 Plus Bioinformatics Softwaew and NCBI BLAST, and purchased from Eurofins Genomics. The cells were incubated at 37ºC, 5% CO2 with Opti-MEM for 24 hours for efficient gene silencing.
Antibodies, Protein A/G agarose gel beads, and protein ladders were obtained from Santa Cruz Biotechnology, UK and Cell Signalling Technologies, UK. DMEM culture medium and other cell culture materials were purchased from Lonza, UK. PCR primers were designed with Primer3 Plus Bioinformatics Softwaew and NCBI BLAST, and purchased from Eurofins Genomics. The cells were incubated at 37ºC, 5% CO2 with Opti-MEM for 24 hours for efficient gene silencing.
4
Knockdown of EMC1, C18, and SGTA in CV-1 and COS-7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All Star Negative purchased from Qiagen (Valencia, CA) was used as the control siRNA (labeled as scrambled). Pre-designed siRNAs against EMC1 (ID: 122744 for EMC1 siRNA#1, ID: 122746 for EMC1 siRNA#2) were purchased from Thermo Fisher Scientific (Waltham, MA). Custom siRNA sequences for C18 and SGTA were generated and purchased from Dharmacon (Pittsburgh, PA) or Invitrogen. Their sequences are:
C18 siRNA: 5' GCUAUGAUGAAUACGGAGAUU 3'
5' UCUCCGUAUUCAUCAUAGCUU 3'
SGTA siRNA: 5’ CCAACCUCAAGAUAGCGGAGCUGAA 3’
5’ UUCAGCUCCGCUAUCUUGAGGUUGG 3’
Using Lipofectamine RNAiMAX (Invitrogen), 50 nM of EMC1 or C18 siRNA, or 12.5 nM of SGTA siRNA, was reverse transfected into CV-1 or COS-7 cells. Infection or biochemical assays were carried out at 24 or 48 hr post transfection.
C18 siRNA: 5' GCUAUGAUGAAUACGGAGAUU 3'
5' UCUCCGUAUUCAUCAUAGCUU 3'
SGTA siRNA: 5’ CCAACCUCAAGAUAGCGGAGCUGAA 3’
5’ UUCAGCUCCGCUAUCUUGAGGUUGG 3’
Using Lipofectamine RNAiMAX (Invitrogen), 50 nM of EMC1 or C18 siRNA, or 12.5 nM of SGTA siRNA, was reverse transfected into CV-1 or COS-7 cells. Infection or biochemical assays were carried out at 24 or 48 hr post transfection.
5
Comprehensive siRNA Knockdown of EMC Subunits
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All Star Negative purchased from Qiagen (Valencia, CA) was used as the control siRNA (labeled as scrambled). Pre-designed siRNAs against different EMC subunits (EMC1 siRNA ID: 122744, EMC2 siRNA ID: 21859, EMC3 siRNA ID: 125192, EMC4 siRNA ID: 140362, EMC5 siRNA ID: 128206, EMC6 siRNA ID: 33278, EMC7 siRNA ID: 28005, EMC8 siRNA ID: 135577, EMC9 siRNA ID: 45418, EMC10 siRNA ID: 41417) and pre-designed siRNA against Rab7 (ID: 139428) were purchased from Thermo Fisher Scientific (Waltham, MA). PTDSS siRNAs were generated through Sigma-Aldrich and target the following sequences: siPTDSS1 sense 5’-GCAGCUGACUGAGUUGAAUTT-3’, siPTDSS1 anti-sense 5’-AUUCAACUCAGUCAGCUGCTT-3’; siPTDSS2 sense 5’-GCACCGAGUCCGAGGUCUATT-3’, siPTDSS2 anti-sense 5’-UAGACCUCGGACUCGGUGCTT-3’. Lipofectamine RNAiMAX (Thermo Fisher Scientific) was used as the siRNA transfection reagent. All siRNAs were reverse transfected at the time of cell seeding. Knockdowns were carried out for 48 hours before experiments were conducted.
6
Human HO-1 Gene Silencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-designed si-RNA and negative control si-RNA to silence the human HO-1 gene were purchased from Ambion (Foster City, CA, USA). For transfection, cells were seeded into 6-well plates, incubated for 24 h, then transfected with HO-1 si-RNA (100 nM), or negative control si-RNA, using Lipofectamine® RNAiMAX Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After subsequent treatments, cells were harvested for analysis.
7
Phb1 Silencing in RAW 264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-designed siRNA targeting mouse Phb1 (sense: AGAGCGAGCGGCAACAUUUTT , antisense: AAAUGUUGCCGCUCGCUCUGT ) and nonspecific scrambled siRNA were purchased from Ambion Inc. (Austin, TX, USA). RAW 264.7 cells were plated on 6-well plates and transfected with 13 nM siPhb1 or scramble siRNA using Lipofectamine RNAiMAX (Invitrogen Inc., Carlsbad, CA, USA) according to the manufacturer’s manual.
8
Lentiviral HO-1 Overexpression and Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A recombinant lentiviral vector overexpressing HO-1 (LV-HO-1) was generated by GeneChem (Shanghai, China). Negative control siRNA (NC-siRNA) and pre-designed siRNA targeting HO-1 (HO-1-siRNA) to silence the human HO-1 gene were purchased from Ambion (Foster City, CA, USA). For transfection, cells were seeded into 6-well plates, incubated for 24 h, and then transfected according to the manufacturer's instructions. After subsequent treatments, cells were harvested for flow cytometry and for protein extraction for use in western blot experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!