M mlv reverse transcriptase

Cells were washed twice in PBS and RNA was extracted using TRIzol Reagent (Ambion) according to the manufacturer’s instructions. Duplicate cDNA preparations from each sample were generated from 1 μg of RNA using Moloney murine leukaemia virus (M‐MLV) reverse transcriptase (Sigma‐Aldrich) according to the manufacturer’s instructions. Quantitative real‐time PCR analysis of gene expression was undertaken using the KAPA SYBR FAST qPCR Kit and a Rotor-Gene Q real-time PCR cycler System (Qiagen). Thermal cycling conditions were as follows: 95 °C for 3 min for enzyme activation, 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 20 s. Primers used in qPCR reactions are listed in Supplementary Table 1. cDNA samples were tested in duplicate and relative mRNA quantity was determined by the comparative threshold cycle (ΔΔC_T) method, using glyceraldehyde 3-phosphate dehydrogenase (hGAPDH) gene normalisation.

Total RNA was extracted from hMSCs-derived hepatocytes under various culture conditions, HepG2 cells and untreated hMSCs using TRI Reagent (Sigma) as per manufacturer’s protocol and quality and quantity of RNA was measured spectrophotometrically. For cDNA synthesis, 5 μg of total RNA was transcribed with MMLV-reverse transcriptase (Sigma). Quantitative real time-PCR for early hepatic genes such as AFP, HNF-4α and late hepatic genes such as CY-18 and ALB were carried out with Mastercycler ep realplex (Eppendorf, Germany) using SYBR Green JumpStart TaqReadyMix (Sigma). Assessment of mesenchymal-to-epithelial transition during hepatic differentiation of hMSCs was done by evaluating changes in expression of mesenchymal marker (SNAIL) and epithelial marker (CDH1, E-Cadherin). The primer sequence details are specified in Table S2. The experiment was performed in a 20 μl reaction mixture of 2× SYBR Green PCR Master Mix, 30 ng template cDNA and 5 pmol forward and reverse primers, for a total of 40 cycles with annealing temperature of 60°C. Relative quantification of gene expression in unknown samples was performed using the comparative C_T (2^–ΔΔCT) method by normalizing with a housekeeping gene (glyceraldehyde-3-phosphate dehydrogenase) and untreated hMSCs were used as the calibrator. All reactions were performed in triplicate for statistical validation.

The fragment corresponding to LHCSR1 (Locus XM_024529130) was amplified from P. patens total cDNA obtained from 6-days-old plants grown on minimal medium, RNA was isolated using TRI Reagent^® Protocol (T9424, Sigma-Aldrich) and cDNA was synthetized using M-MLV Reverse Transcriptase (M1302, Sigma-Aldrich) and Oligo(dT)₂₃ (O4387, Sigma-Aldrich). Primers including attB sequences for the gateway technology (Invitrogen™) were designed to anneal 27 base pairs upstream of the ATG codon (PpLHCSR1attB1 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCAATCTCGAGCTTTTGCT-3′) and 107 base pairs downstream of the stop codon (PpLHCSR1attB 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTCGACTGCGAATCAATCAGAA-3′). The PCR-product was first cloned in pDONR™221 Vector (12536-017, Invitrogen™) and then recombined into the pH7WG2 binary vector (Karimi et al. 2002 (link)) to make the 35S::lhcsr1 construct. The accuracy of the cloning was verified by DNA digestion and sequencing and the plasmid was transferred to Agrobacterium tumefaciens strain GV3101 (Zhang et al. 2006 (link)). A. thaliana plants were transformed by the floral dip method and transgenic plants were selected on Murashige-Skoog medium supplemented by hygromycin (25 mg L⁻¹) and carbenicillin (100 mg L⁻¹) (Clough and Bent 1998 (link)).

Total RNA was isolated from cells with High Pure Isolation Kit (Roche). For cDNA synthesis random nonamers, oligo(dT)23 and M-MLV reverse transcriptase (Sigma-Aldrich) were used according to the manufacturer’s instructions. To estimate the expression of genes of interest we used primers designed with NCBI tool (and custom-synthesized by Sigma-Aldrich) listed in Supplementary file 1-Table 5. The qRT-PCR reaction was performed with the Kapa Sybr Fast ABI Prism qPCR Kit (KapaBiosystems) using a 7900HT Fast Real-Time PCR thermocycler (Applied Biosystems) with at least three technical repeats per experimental condition. The data were normalized according to the expression level of housekeeping gene, GAPDH (in K562 cells) or RPL19 (in mouse fetal liver erythroblasts) and presented as fold changes.

RNA was extracted with Trizol (Life Technologies) according to the manufacturer's instructions. RNA was reverse-transcribed to generate complementary DNA using M-MLV Reverse Transcriptase (Sigma). Real-time qRT-PCR was performed with FastStart Universal Probe Master (Rox) (Roche) and TaqMan Gene Expression Assay probes on an Applied Biosystems 7900HT Fast Real Time machine. Relative MATN2 (hs00242753_m1, Life Technologies) expression was calculated using the ΔCt method and housekeeping genes (GAPDH) as an internal control.

Total RNA was isolated with High Pure Isolation Kit (Roche, 11828665001). For cDNA synthesis random nonamers, oligo(dT)23 and M‐MLV reverse transcriptase (Sigma‐Aldrich, R7647, O4387, and M1302, respectively) were used according to manufacturer's instructions. Expression of genes of interest was measured using primers designed with the NCBI tool (and custom‐synthesized by Sigma‐Aldrich) listed in Appendix Table S2 or the following TaqMan^® Gene Expression Assays: Hs99999903_m1 for ACTB, Hs00203085_m1 for VPS4A and Hs00191617_m1 for VPS4B (Thermo Fisher Scientific). The qRT–PCR mixture was performed with the Kapa Sybr Fast qPCR Kit (KapaBiosystems, KK4618) or TaqMan^® Gene Expression Master Mix (Thermo Fisher Scientific, 4369016) using a 7900HT Fast Real‐Time PCR thermocycler (Applied Biosystems) with two technical repeats per experimental condition. The data were normalized according to the level of housekeeping genes ACTB or Rpl19 and presented as fold changes.

Total RNA was isolated using the Extractme kit (Blirt DNA, Gdansk, Poland). One microgram of RNA was reverse transcribed using M-MLV reverse transcriptase (Sigma Aldrich, St. Louis, MO, USA). mRNA levels were then analyzed by RT-qPCR using the SYBRGreen system with 18S rRNA as a standard. The primers used are listed in Supplementary Table S1. The results were analyzed by absolute quantification with a relative standard curve and normalized to 18S rRNA using the comparative ΔΔCt method.