Log In Sign up
The largest database of trusted experimental protocols

Anti ar sc 816

Manufactured by Santa Cruz Biotechnology
Visit Supplier
Sourced in United States

The Anti-AR (sc-816) is a primary antibody produced by Santa Cruz Biotechnology. It is designed to detect the androgen receptor (AR) protein.

Automatically generated - may contain errors

Lab products found in correlation

Api delta vision, by Cytiva (2 mentions) Anti vamp7 nb100 91356, by Novus Biologicals (2 mentions) Esr1 ma1 310, by Thermo Fisher Scientific (2 mentions) Softworx, by Cytiva (2 mentions) Anti rab5, by Cell Signaling Technology (2 mentions) Alexa conjugated secondary antibody, by Thermo Fisher Scientific (2 mentions) Anti apc sc 896, by Santa Cruz Biotechnology (2 mentions) Anti β catenin 610181, by BD (2 mentions) Anti chromogranin a ab1560 1, by Abcam (2 mentions) Anti mlh1 ab92312, by Abcam (2 mentions) Anti sox9 ab5535, by Abcam (2 mentions) Anti p mek1 ab59329, by Abcam (2 mentions) Anti ck17 19 3984, by Cell Signaling Technology (2 mentions) Anti msh2 d24b5, by Cell Signaling Technology (2 mentions) Anti p21 ls c88585, by LifeSpan BioSciences (2 mentions) Dab kit, by Vector Laboratories (2 mentions) Anti p53 cm5, by Vector Laboratories (2 mentions) Anti γh2ax, by Cell Signaling Technology (2 mentions) Vectastain abc kit, by Vector Laboratories (2 mentions) Sc 542, by Santa Cruz Biotechnology (1 mentions)

9 protocols using anti ar sc 816

1

Immunohistochemical Analysis of Steroid Receptors

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The primary antibodies used in the present study included rabbit polyclonal anti-AR (sc-816, Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit polyclonal anti-ERα (sc-542, Santa Cruz Biotechnology), rabbit polyclonal anti-ERβ (sc-8974, Santa Cruz Biotechnology), rabbit polyclonal anti-P450arom (derived from human Aromatase C-terminus, sc-30086, Santa Cruz Biotechnology). The dilution ranges of AR, ERα, ERβ and Aromatase antibodies for immunohistochemistry were all 1:500. The specificity of AR, ERα, ERβ and P450Arom antibodies have been described in our previous studies on WGS.14 (link),24 (link) The immunohistochemistry kits with the secondary antibody of goat anti-rabbit was applied corresponding with the primary antisera.
Li Q., Zhang F., Zhang S., Sheng X., Han Y., Yuan Z, & Weng Q. (2015). Seasonal Expression of Androgen Receptor, Aromatase, and Estrogen Receptor Alpha and Beta in the Testis of the Wild Ground Squirrel (Citellus Dauricus Brandt). European Journal of Histochemistry : EJH, 59(1), 2456.
+ Open protocol
+ Expand
2

AR Knockdown in Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two siRNAs from Invitrogen, AR/HSS179973 (siRNA#1) and AR/HSS179972 (siRNA#2), were used to knock down AR expression in LNCaP-TGF-β1(a) cells and LNCaP-Ctrl cells. The corresponding sequences are CCGGAAGCUGAAGAAACUUGGUAAU (sense), AUUACCAAGUUUCUUCAGCUUCCGG (antisence) for AR/HSS179973, and GAUGAAGCUUCUGGGUGUCACUAUG (sense), CAUAGUGACACCCAGAAGCUUCAUC (antisense) for AR/HSS179972. siRNAs were transfected into LNCaP cells using GenMute™ siRNA Transfection Reagent following manufacture's protocol (SignaGen, Rockville, MD, USA). Western blots were used to verify knockdown of AR. Antibodies used are anti-AR (sc-816, Santa Cruz Biotechnology, Dallas, TX, USA) and anti-β-actin (A1978, Sigma).
Yang F., Chen Y., Shen T., Guo D., Dakhova O., Ittmann M.M., Creighton C.J., Zhang Y., Dang T.D, & Rowley D.R. (2014). Stromal TGF-β signaling induces AR activation in prostate cancer. Oncotarget, 5(21), 10854-10869.
+ Open protocol
+ Expand
3

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in cell lysis buffer, and 30–50 μg of protein was mixed and boiled for equal loading, separated on 6–10% SDS/PAGE gels, and then transferred to PVDF membranes (Millipore, Billerica, MA, USA). We dissolved 5% skim milk in a TBST solution for blocking. After 1 h of blocking, the membranes were incubated with specific primary antibodies overnight, and then HRP-conjugated secondary antibodies were added for 1 h. An ECL system (Thermo Fisher Scientific, Rochester, NY, USA) was used for visualization. The primary antibodies used in the study included the following, anti-AR (sc-816, Santa Cruz, Dallas, TX, USA), anti-PD-L1 (#13684, Cell Signaling Technology, Danvers, Mass, USA), anti-GAPDH (sc-47724, Santa Cruz), anti-α-tubulin (sc-8035, Santa Cruz).
Liu Q., You B., Meng J., Huang C.P., Dong G., Wang R., Chou F., Gao S., Chang C., Yeh S, & Xu W. (2022). Targeting the androgen receptor to enhance NK cell killing efficacy in bladder cancer by modulating ADAR2/circ_0001005/PD-L1 signaling. Cancer Gene Therapy, 29(12), 1988-2000.
+ Open protocol
+ Expand
4

Immunofluorescence Staining of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were rinsed twice in ice-cold phosphate-buffered saline (PBS) and fixed with a freshly prepared solution of 4% paraformaldehyde in PBS for 20 minutes and permeabilized for 10 minutes with 0.1% digitonin in PBS. After several rinses in ice-cold PBS, cells were incubated in 3% normal goat serum in PBS (blocking solution) for 30 minutes at room temperature, followed by an overnight incubation at 4°C with primary antibodies. Cells were extensively washed with PBS-0.1% digitonin and then incubated with Alexa-conjugated secondary antibodies (Molecular Probes) for 60 minutes at room temperature. Coverslips were mounted in a mounting medium. Images were captured with an API Delta Vision deconvolution microscope using SoftWorx software (Applied Precision, Issaquah, Washington, USA). Primary antibodies used were anti-AR (Sc-816, 1:200, Santa Cruz Biotechnology Inc.), anti-VAMP7 (NB100-91356, 1:1,000, Novus Biologicals), ESR1 (MA1-310, 1:200, Thermo-Fisher) and anti-RAB5 (#2143, 1:100, Cell Signaling).
Tannour-Louet M., Han S., Louet J.F., Zhang B., Romero K., Addai J., Sahin A., Cheung S.W, & Lamb D.J. (2014). Increased gene copy number of the vesicle SNARE VAMP7 disrupts human male urogenital development through altered estrogen action. Nature medicine, 20(7), 715-724.
+ Open protocol
+ Expand
5

Hippocampal Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Proteins (30 μg) were extracted from the hippocampus, separated on a 7.5% polyacrylamide gel and transferred onto nitrocellulose membranes as previously described [33 (link)]. The blots were probed overnight at 4°C with polyclonal rabbit (1/400 anti-AR #sc-816 and 1/400 anti-ERα #sc-542; Santa-Cruz Biotechnology) or monoclonal mouse antisera (1/10000 anti-glyceraldehyde 3-phosphate dehydrogenase gene (GAPDH) #sc-32233 from Santa-Cruz Biotechnology). They were then incubated with horseradish peroxidase-conjugated secondary anti-rabbit #111.035.144 or anti-mouse #115.035.062 antisera (1/5000, Jackson Immunoresearch). Signals were visualized with pico- (for GAPDH) and femto- (for AR and ERα) Super Signal detection kit (Thermo Scientific), quantified with ImageJ software (NIH) and normalized with respect to GAPDH. As we have previously shown by immunohistochemistry [33 (link)], AR protein was detected in the hippocampus of control (ARfl/Y) males but not in their mutant (ARNesCre) littermates (Fig 1A). By contrast, hippocampal ERα protein was present in both ARfl/Y and ARNesCre males (Fig 1B). Quantification of ERα protein normalized to GAPDH showed similar amounts in the two genotypes (Fig 1C).
Picot M., Billard J.M., Dombret C., Albac C., Karameh N., Daumas S., Hardin-Pouzet H, & Mhaouty-Kodja S. (2016). Neural Androgen Receptor Deletion Impairs the Temporal Processing of Objects and Hippocampal CA1-Dependent Mechanisms. PLoS ONE, 11(2), e0148328.
+ Open protocol
+ Expand
6

Immunofluorescence Staining of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were rinsed twice in ice-cold phosphate-buffered saline (PBS) and fixed with a freshly prepared solution of 4% paraformaldehyde in PBS for 20 minutes and permeabilized for 10 minutes with 0.1% digitonin in PBS. After several rinses in ice-cold PBS, cells were incubated in 3% normal goat serum in PBS (blocking solution) for 30 minutes at room temperature, followed by an overnight incubation at 4°C with primary antibodies. Cells were extensively washed with PBS-0.1% digitonin and then incubated with Alexa-conjugated secondary antibodies (Molecular Probes) for 60 minutes at room temperature. Coverslips were mounted in a mounting medium. Images were captured with an API Delta Vision deconvolution microscope using SoftWorx software (Applied Precision, Issaquah, Washington, USA). Primary antibodies used were anti-AR (Sc-816, 1:200, Santa Cruz Biotechnology Inc.), anti-VAMP7 (NB100-91356, 1:1,000, Novus Biologicals), ESR1 (MA1-310, 1:200, Thermo-Fisher) and anti-RAB5 (#2143, 1:100, Cell Signaling).
Tannour-Louet M., Han S., Louet J.F., Zhang B., Romero K., Addai J., Sahin A., Cheung S.W, & Lamb D.J. (2014). Increased gene copy number of the vesicle SNARE VAMP7 disrupts human male urogenital development through altered estrogen action. Nature medicine, 20(7), 715-724.
+ Open protocol
+ Expand
7

Immunostaining Protocol with Antigen Retrieval

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunostaining was performed with antigen retrieval (20–30′ in boiling 10mM sodium citrate pH 6.0, 0.05% Tween 20) and by incubating primary antibodies overnight at 4°C. Detection and staining was performed with Vectastain ABC kit and DAB kits (Vector laboratories). Slides were counterstained with Hematoxylin. Antibodies used: anti-APC #sc-896 and anti-AR #sc-816, from Santa Cruz Technology; anti-β-catenin #610181 (BD); anti-chromogranin A #ab1560-1, anti-MLH1 #ab92312, anti-Sox9 # ab5535, and anti-P-MEK1 ab59329 from Abcam; anti-ck17/19 #3984, anti-MSH2 #D24B5, and anti-γ-H2AX #9718, from Cell Signaling; anti-p21 #LS-C88585 (Lifespan Biosciences), and anti-p53 #CM5 (Vector Laboratories).
Parisi T., Bronson R.T, & Lees J.A. (2015). Inactivation of the retinoblastoma gene yields a mouse model of malignant colorectal cancer. Oncogene, 34(48), 5890-5899.
+ Open protocol
+ Expand
8

Androgen Receptor Signaling Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
LNCaP and VCaP cells were cultured in phenol red-free RPMI 1640 medium supplemented with 2% cFBS for 1 day and treated with 1.0 µg/mL DNT or 1 nM R1881 for the indicated durations. Preparation of cell lysate and western blot analysis was carried out as described previously [24 (link)]. The primary antibodies used included anti-AR (sc816, Santa Cruz, Dallas, TX, USA), anti-PSA (ab76113, Abcam, Cambridge, UK), anti-Cyclin D1 (sc-246, Santa Cruz), anti-nucleolin (sc-13057, Santa Cruz), and anti-tubulin (T5168, Sigma-Aldrich).
The fractionation of LNCaP cells into cytosolic and nuclear fractions was performed using a nuclear/cytosol fractionation kit (BioVision Inc., Mountain View, CA) according to the manufacturer’s instructions. Digitalization was performed with ImageJ.
YAMAZAKI Y., KAWADA M, & MOMOSE I. (2023). Deoxynortryptoquivaline: A unique antiprostate cancer agent. Oncology Research, 31(6), 845-853.
+ Open protocol
+ Expand
9

Immunostaining Protocol with Antigen Retrieval

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunostaining was performed with antigen retrieval (20–30′ in boiling 10mM sodium citrate pH 6.0, 0.05% Tween 20) and by incubating primary antibodies overnight at 4°C. Detection and staining was performed with Vectastain ABC kit and DAB kits (Vector laboratories). Slides were counterstained with Hematoxylin. Antibodies used: anti-APC #sc-896 and anti-AR #sc-816, from Santa Cruz Technology; anti-β-catenin #610181 (BD); anti-chromogranin A #ab1560-1, anti-MLH1 #ab92312, anti-Sox9 # ab5535, and anti-P-MEK1 ab59329 from Abcam; anti-ck17/19 #3984, anti-MSH2 #D24B5, and anti-γ-H2AX #9718, from Cell Signaling; anti-p21 #LS-C88585 (Lifespan Biosciences), and anti-p53 #CM5 (Vector Laboratories).
Parisi T., Bronson R.T, & Lees J.A. (2015). Inactivation of the retinoblastoma gene yields a mouse model of malignant colorectal cancer. Oncogene, 34(48), 5890-5899.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!