Pcr7900

Total RNA including miRNA was isolated from tumor sections using the miRNeasy FFPE Kit (QIAGEN, KJ Venlo, Netherlands) according to our previous reports [26 (link)–28 (link)]. RNA concentrations were determined by Nanodrop 2000 (Wilmington, DE , USA). A combination of RUN6B and RUN48 was the housekeeping genes for detection of miR-148a expression [27 (link),28 (link)]. The primers for miR-148a, RNU6B and RNU48 were included in TaqMan® MicroRNA Assays (4427975, Applied Biosystems, Life Technologies Grand Island, NY, USA). The reverse primers were also used for reverse transcription with TaqMan® MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies Grand Island, NY, USA) in a total volume of 10 μl. Real time RT-qPCR for miRNA was performed with Applied Biosystems PCR7900. The miR-148a abundance in each sample was normalized to its references. The expression of miR-148a in the FFPE experiments was calculated with the formula 2^-Δcq [26 (link)–29 (link)].

Extraction and normalization of RNAs along with miRNAs by using the miRNeasy FEPE Kit (QIAGEN, KJ Venlo, Netherlands) were performed as described previously [27 (link)–30 (link)]. RNA concentrations were determined by NanoDrop 2000 (Wilmington, DE, USA). A combination of RUN6B and RUN48 was the housekeeping gene for detection of miR-203 expression in HCC FFPE tissues [27 (link), 28 (link)]. The primers for miR-203, RNU6B and RNU48, were included in TaqMan®MicroRNAAssays (4427975, Applied Biosystems, Life Technologies, Grand Island, NY, USA). Sequence of miRNA and references used in the paper are as follows: miR-203 (Applied Biosystems Cat. No. 4427975–000507): GUGAAAUGUUUAGGACCACUAG; RNU6B (Applied Biosystems Cat. No. 4427975–001093): CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU; RNU48 (Applied Biosystems Cat. No. 4427975–001006): GAUGACCCCAGGUAACUCUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC. The reverse primers were also used for reverse transcription with TaqMan®MicroRNA Reverse Transcription Kit (Amsterdam, Netherland, Applied Biosystems, Life Technologies) in a total volume of 10 μL. Real-time qPCR for miRNA was performed with Applied Biosystems PCR7900. The miR-203 abundance in each sample was normalized to its references. The expression of miR-203 in the FFPE experiments was calculated with the formula 2^-Δcq [27 (link)–31 (link)].

Meanwhile, RT-qPCR was employed to detect and monitor the transfection efficiency. The entire RNA with miRNA included was extracted from HCC cells in corresponding groups respectively. The housekeeping reference here was the combination of RNU6B and let-7a for the purpose of miR-132 expression detection. The primers for miR-132, RNU6B and let-7a were maintained in TaqMan MicroRNA Assays (4427975, Applied Biosystems, Life Technologies Grand Island, NY 14072 USA). Sequence of miRNA and references were: miR-132: 000457; RNU6B: 001093; let-7a: 000377. In terms of reverse transcription, a total volume of ten microliters was applied with TaqMan MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies Grand Island, NY 14072 USA) with the exact same reverse primers. Real-time qPCR was conducted with Applied Biosystems PCR7900 as previously described [16 (link)–19 (link)], which was in the charge of detecting and monitoring miRNA expression.

Total RNA was extracted from 39 HCC samples and corresponding adjacent non-tumour tissues using the Qiagen RNeasy FFPE Kit following the manufacturer’s protocol as previously reported [16 (link), 17 (link)]. The quantification of CTD-2547G23.4 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was performed by Applied Biosystems PCR7900. The sequences of the CTD-2547G23.4 primer were as follows: F: TTTGGTCTCTTCGGGTCATC, R: CTTAGCTGGACGCCTACCTG. For GAPDH, the primers were: F: GTAAGACCCCTGGACCACCA, R: CAAGGGGTCTACATGG CAACT. The expression were calculated using the 2^−ΔCt method.

RNA isolation and RNA normalization were performed as described formerly [29 (link)]. We applied reverse transcription (RT) and qPCR kits based on precedents in order to examine the expression of miR-133a as reported previously [30 (link)]. RT process for microRNA complied strictly with the instructions of the manufacturer. Previously, we discovered that the aggregation of miR-191 and miR-103 was the most stable housekeeping miRNA by using NormFinder and geNorm. This combination was adopted in the current study for the evaluation of miR-133a expression. The primers for miR-133a, miR-191, and miR-103 were included in TaqMan® MicroRNA Assays (4427975, Applied Biosystems, Life Technologies, Grand Island, NY, USA). Sequences of targeted miRNAs and reference miRNAs used were as follows: miR-133a (Applied Biosystems Cat. No. 4427975-000458): UUGGUCCCCUUCAACCAGCUGU; miR-191 (Applied Biosystems Cat. No. 4427975-000490): CAACGGAAUCCCAAAAGCAGCU; miR-103 (Applied Biosystems Cat. No. 4427975-000439): AGCAGCAUUGUACAGGGCUAUGA. The reverse primers were also used for the reverse transcription with TaqMan® MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies, Grand Island, NY, USA) in a total volume of 10 μl. We carried out real-time qPCR for miRNA using Applied Biosystems PCR7900. The expression of miR-133a was determined with the formula 2^−Δcq [31 (link)].

The total RNA including miRNA was isolated from HCC cells as reported [36 –41 ]. Combination of RUN6B and let-7a was used as the housekeeping gene for the detection of miR-146a expression. GAPDH was used as internal reference for EGFR mRNA. The primers for miR-146a, RNU6B, and let-7a were included in TaqMan MicroRNA Assays (4427975, Applied Biosystems, Life Technologies Grand Island, NY, USA). Sequence of miRNA and references used in the paper were miR-146a (Applied Biosystems Cat. number 4427975-000468): UGAGAACUGAAUUCCAUGGGUU; RNU6B (Applied Biosystems Cat. number 4427975-001093): CGCAAGGAUGA CACGCAAAUUCGUGAAGCGUUCCAUAUUUUU; let-7a (Applied Biosystems Cat. number 4427975-000377): UGAGGUAGUAGGUUGUAUAGUU. The reverse primers were also used for the reverse transcription with TaqMan MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies Grand Island, NY, USA) in a total volume of 10 μL. Real-time qPCR for miRNA was performed with Applied Biosystems PCR7900. The alteration ratio of miR-146a was (1–1/2^ΔΔCq) × 100% [37 , 41 ]. Real time RT-qPCR for EGFR was performed as reported [36 , 38 (link)–41 ].