Total rna kit

Utilizing the Total RNA kit to extract total RNA from grown cells (Vazyme, China). Using the Prime Script RT Reagent Kit, reverse transcription was carried out (Takara, Japan). The HiScript II One Step RT-PCR Kit was used to perform the reverse transcription-polymerase chain reaction (Vazyme, China). All primers were obtained from Sangon Biotech (Suzhou, China). The primer sequences are:

All fresh frozen tissues were archived from The Sixth Affiliated Hospital of Sun Yat-Sen University. The related protocol of human sample usage and the informed consent was approved by the Ethical Review Board of the The Sixth Affiliated Hospital of Sun Yat-Sen University.
Total RNA was extracted from the tumor and normal tissues of 12 patients using Total RNA Kit (Vazyme, China) according to the manufacturer’s instruction. Detailed information of these 12 patients can be found in Supplementary Table S1. For cDNA synthesis, 1 μg total RNA was reverse-transcribed into cDNA by Hiscript@ III RT Super Mix with gDNA wiper (Vazyme, Nanjing, China). Quantitative PCR reaction was then performed using 2×SYBR mix (Vazyme, China) and the reaction was run on Applied Biosystems 7500 Real-time PCR system. The Ct values obtained from different samples were compared using the 2-ΔΔCt method. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as internal reference genes. Sequence information of all used primers is listed in Supplementary Table S2.

Total RNA was extracted from mPFC using a total RNA Kit (Vazyme Biotech Co., Ltd., China), and complementary DNA (cDNA) was generated using a cDNA Synthesis Kit (DBI^® Bioscience Co., Ltd., Germany), according to instructions provided by the manufacturers. RT-qPCR was carried out using an SYBR Green assay (DBI^® Bioscience) on a StepOnePlus Real−Time PCR System (Applied Biosystems^®, Thermo Fisher Scientific, Waltham, MA, USA), and the relative gene expression was determined using the comparative Ct (ΔΔCt) method. GAPDH was used as a housekeeping gene. The primer sequences are as Supplementary Table 1.

Total RNA was extracted from the cultured cells using a Total RNA kit (Vazyme, China). Reverse transcription was carried out using the Prime Script RT Reagent Kit (Takara, Japan). Reverse transcription-polymerase chain reaction (RT-PCR) was conducted using the HiScript II One-Step RT-PCR Kit (Vazyme, China). All primers for the PCR amplification were obtained from Sangon Biotech (Suzhou, China). The relative gene expression was normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analyzed using the 2^ΔΔCt method. The results were compared to those of the vehicle control. The utilized primer sequences are listed in Table 1.Table 1

Sequences of primers utilized in the reverse transcription-polymerase chain reaction.

Gene	Forward primer (5–3)	Reverse primer (5–3)
iNOS	CGGACGAGACGGATAGGCAGAG	GGAAGGCAGCGGGCACATG
Cox2	AGCAGGCAGATGAAATACCAGTCT	ATACAGCTCCACAGCATCGATGT
Arg1	CTCCAAGCCAAAGTCCTTAGAG	AGGAGCTGTCATTAGGGACATC
YM1	CAGGTCTGGCAATTCTTCTGAA	GTCTTGCTCATGTGTGTAAGTGA
GAPDH	AATGGGCAGCCGTTAGGAAA	GCCCAATACGACCAAATCAGAG

Arg1, arginase 1; COX-2, cyclooxygenase-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; iNOS, inducible nitric oxide synthase; YM1, chitinase-like protein-1.

Real-time quantitative polymerase chain reaction was used to determine relative mRNA expression levels of tight junction protein ZO-1, claudin-1, occludin, and Muc-2. Colon tissue RNA levels were obtained and quantified using the Total RNA kit (Vazyme, Nanjing, China), and 2000C Ultra-micro UV spectrophotometer (Thermo Fisher Scientific Inc., USA), respectively. We used the Transcriptor First Strand cDNA Synthesis kit (Promega, Madison, USA) to synthesize cDNA for this study. The GoTaq°R SYBR-Green qPCR Master Mix (Promega, Madison, USA) was used to perform RT-qPCR corrections. The relative mRNA expressions of specific genes were calculated by the 2^−ΔΔCT method. GAPDH genes are used as internal reference genes. Supplementary Table S3 displays the specific gene primers as designed by Sangon Biotech Co., Ltd (Shanghai, China).