Abi 7900 fast system

The TRIzol kit (Invitrogen Life Technologies, Carlsbad, CA, USA) was employed to extract total RNA from synovial tissues and serums. The concentration, purity and integrality of the total RNA were evaluated by agarose gel electrophoresis and ultraviolet spectrophotometry. The total RNA was reversely transcribed into cDNA with the miRNA First Strand cDNA Synthesis Tailing Reaction Kit (Sangon Biotech, Shanghai, China). Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) was used to measure miRNA-146a and miRNA-223 expression levels with TaqMan miRNA assay kits (Applied Biosystems, Foster City, CA, USA) on a ABI 7900 Fast system (Applied Biosystems, Foster City, CA, USA). The 2^–ΔΔCt method was used to evaluate miRNA-146a and miRNA-223 expression levels using U6 as the internal reference.

Total RNA was extracted from tissue samples and cultured cells using TRIzol® reagent (Invitrogen) following the manufacturer’s instructions. Reverse transcription was performed for quantification using the TaqMan miRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) or a Prime Script First Strand cDNA Synthesis kit (Takara, Dalian, China) according to the manufacturer’s protocol. The cDNAs were amplified using TaqMan miRNA kit (Applied Biosystems) or SYBR Premix Ex Taq (Takara) using the ABI 7900 Fast System (Applied Biosystems). The primers are listed in Table 1. Relative gene expression was calculated according to the 2^–ΔΔCt method after normalization to U6 for miR-506-3p or GAPDH for HOXA11-AS or NEK6.Table 1

Real-time PCR primers used for mRNA expression analysis

Target gene	Prime(5ʹ-3ʹ)
U6	F- TCCGATCGTGAAGCGTTCR- GTGCAGGGTCCGAGGT
miR-506-3p	F- GCCACCACCATCAGCCATACR- GCACATTACTCTACTCAGAAGGG
HOXA11-AS	F- AGAAATCTGGACCCGAGACGR- CGTCAGCTTACGTCTCCAAA
NEK6	F- TTCCAACAACCTCTGCCACACCR- CACAGTCCTGCCTCGCCTTG
GAPDH	F- AAGGTGAAGGTCGGAGTCAAR- -AATGAAGGGGTCATTGATGG

Abbreviations: F, forward; mRNA, messenger RNA; PCR, polymerase chain reaction; R, reverse.

Total RNA was extracted from paired cervical cancer tissues and cultured cells with TRIzol^® reagent (Life Technology, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The relative level of miR-1193 and U6B was detected using a SYBR^® PrimeScript^® miRNA RT-PCR Kit (TaKaRa, Dalian, Liaoning, P. R. China) according to the manufacturer’s instructions. For detection of CLDN7 and GAPDH mRNA expression, the first-strand cDNA was synthesized using M-MLV Reverse Transcriptase (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instructions. qRT-PCR was conducted using SYBR Premix Ex Taq (TaKaRa, Dalian, Liaoning, China) in the ABI 7900 Fast system (Applied Biosystems, Foster City, CA, USA). The relative expression of miR-1193 and CLDN7 was normalized to U6B and GAPDH, respectively, by using the 2^−ΔΔCT method.

Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific). The level of miRNA-139-3p was detected using a SYBR PrimeScript miRNA RT PCR kit (Takara, Dalian, China). For detection of the mRNA level of ELAVL1, first-strand cDNA synthesis was conducted using MMLV reverse transcriptase (Promega). qRT-PCR was conducted using SYBR Premix Ex Taq (TaKaRa) in ABI 7900 Fast system (Applied Biosystems, CA, USA). The primers for ELAVL1 and GAPDH were as following: ELAVL1 forward: 5ʹ-ATGAAGACCACATGGCCGAAGACT-3ʹ; reverse: 5ʹ-AGTTCACAAAGCCATAGCCCAAGC-3ʹ; GAPDH forward: 5′-ACAACTTTGGTATCGTGGAAGG-3′; reverse: 5′-GCCATCACGCCACAGTTTC-3′. miR-129-3p forward: 5′-AAGCCCTTACCCCAAAAAGTAT-3′; reverse: 5′-CTTTTTGCGGTCTGGGCTTGC-3′; fibronection forward: 5′-CGGTGGCTGTCAGTCAAAG-3′; reverse: 5′-AAACCTCGGCTTCCTCCATAA-3′; Vimentin forward: 5′-GACGCCATCAACACCGAGTT-3′; reverse: 5′-CTTTGTCGTTGGTTAGCTGGT-3′; ZO-1 forward: 5′-CAACATACAGTGACGCTTCACA-3′; reverse: 5′-CACTATTGACGTTTCCCCACTC-3′; β-catenin forward: 5′-AAAGCGGCTGTTAGTCACTGG-3′; reverse: 5′-CGAGTCATTGCATACTGTCCAT-3′; U6 forward: 5ʹ-CTCGCTTCGGCAGCACA-3ʹ, U6 reverse: 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ. The level of miR-139-3p and ELAVL1 were normalized to U6 or GAPDH, respectively, using the 2^−ΔΔCT method.12 (link)

Total RNA was isolated from the frozen tissue samples and the cultured cells using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. Then, cDNA was synthesized from 100 ng of the RNA, using a BcaBEST RNA PCR kit (Takara, Dalian, People’s Republic of China) according to the manufacturer’s instruction. The cDNAs were subjected to the quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Premix Ex Taq (Takara) to detect miR-613 and SOX9 mRNA with the ABI 7900 Fast system (Thermo Fisher Scientific). The primers used in this study have been described previously.15 (link),22 (link) The U6 gene was used as an endogenous control for miRNA expression,25 (link) whereas the GAPDH gene was used as an endogenous control for mRNA expression. The relative expression levels of miR-613 and SOX9 mRNA were calculated using the comparative delta CT (2^−ΔΔCT) method.26 (link)

Total RNA from tissues and cultured cells was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Reverse-transcription reactions were conducted using a PrimeScript first-strand cDNA synthesis kit (Takara Biotechnology Co., Ltd., Dalian, China) following the manufacturer’s protocol. cDNA was amplified using SYBR Premix ExTaq (Takara Biotechnology Co.) in the ABI 7900 fast system (Thermo Fisher Scientific). The primers used in this study are listed in Table 1. Relative quantitation of gene expression levels was calculated according to the 2^−ΔΔCq method following normalization against U6 for miR-497 or GAPDH for SNHG16, BDNF, and YAP1 mRNAs. All reactions were independently performed three times.