We followed the methods of Wang et al. [24 (link), 25 (link)]. Total RNA was extracted with TRIzol and assessed by spectrophotometer. Then, reverse transcription of RNA from each group was performed using Prime Script RT reagent Kit (Beyotime Biotechnology, Shanghai, China). Primer was designed and synthesized by Shanghai Biotechnology Service Company in accordance with Gene sequence in GenBank Gene sequence design, together with Oligo v6.6 (sequences as Table 1 ). qPCR was performed using Premix Ex Taq SYBR-Green PCR (Takara) according to the manufacturer's instructions on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA). The mRNA level of individual genes was normalized to GAPDH and calculated by 2−ΔΔCTdata analysis method.
Primescript rt reagent kit
Manufactured by Beyotime
Sourced in China, United States
The PrimeScript RT Reagent Kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. It includes all the necessary components for the RT-PCR process, such as the reverse transcriptase enzyme, reaction buffer, and primers.
Automatically generated - may contain errors
Lab products found in correlation
Premix ex taq sybr green pcr, by Takara Bio (3 mentions)
Abi prism 7300, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Mycoplasma stain kit, by Merck Group (2 mentions)
Annexin 5 fitc pi detection kit, by Abbkine (2 mentions)
Truseq rna sample preparation kit, by Illumina (2 mentions)
Cell counting kit 8 (cck8), by Dojindo Laboratories (2 mentions)
Jurkat t cells, by American Type Culture Collection (1 mentions)
Hplc grade acetone, by Merck Group (1 mentions)
Sybr premix ex taqtm 2, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Acetone, by Merck Group (1 mentions)
Abi prism 7900 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Sybr green mix, by Beyotime (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Nd 1000, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Agilent Technologies (1 mentions)
Sybr primescript rt pcr kit, by Takara Bio (1 mentions)
9 protocols using primescript rt reagent kit
1
Quantifying Gene Expression by RT-qPCR
2
Cytotoxicity Evaluation of Dimethomorph
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dimethomorph (DMM, 99.9% purity) was obtained from A Chemtek Inc. (Worcester, MA, USA). The human T-lymphocyte cell line (Jurkat T cells) was obtained from the American Type Culture Collection (ATCC, Manassas, VI, USA); this cell line was derived from the peripheral blood of human T-lymphocyte leukemia cells. Acetone (HPLC grade) was purchased from Merck & Co. (Darmstadt, Germany). RPMI-1640 medium, penicillin/streptomycin, phosphate-buffered saline (PBS), and fetal bovine serum (FBS) were all purchased from HyClone (Logan, UT, USA). The Cell Counting Kit-8 was purchased from Dojindo (Kumamoto, Japan). The Annexin V-FITC/PI detection kit was purchased from Abbkine (Wuhan, China). The Mycoplasma Stain Kit was purchased from Sigma Aldrich (St Louis, Missouri, MO, USA), the TruSeqTM RNA Sample Preparation Kit was purchased from Illumina (San Diego, CA, USA), and the PrimeScript RT Reagent Kit was purchased from Beyotime Biotechnology (Shanghai, China). Unless otherwise specified, the reagents used in this study were of analytical grade.
3
RT-qPCR Analysis of KLF16 and LMNB2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using an RNAiso Plus Reagent (Takara). RNA was transcribed using a PrimeScript RT Reagent Kit (Beyotime Biotechnology). RT-qPCR was performed using SYBR Premix Ex TaqTM II (Takara) [24 (link)] on an RT-PCR system (ABI 7500). The qPCR primers used were as follows: 5′-TGGGCAAACCCTGAAGACA-3′ for KLF16-F and 5′-GTTGCACAGATGGGAAGAAA-3′ for KLF16-R, 5-GGCTGCAGGAGAAGGAGGAGCTG-3 for LMNB2-F and 5-CATCACGTAGCAGCCTCTTGAG-3 for LMNB2-R, and 5-CATGTACGTTGCTATCCAGGC-3 for β-actin-F and 5-CTCCTTAATGTCACGCACGAT-3 for β-actin. Gene expression was evaluated using the 2−ΔΔCt method [25 (link)].
4
Pesticide Analysis in Cell Viability Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All pesticides shown in Table S1 were obtained from Alta Scientific Ltd. (Tianjin, China). A 11,000 mg/L stock solution of the pesticides was prepared in acetone (Merck & Co., Darmstadt, Germany) and maintained at −80 °C. RPMI-1640 medium, penicillin/streptomycin, phosphate-buffered saline (PBS), and fetal bovine serum (FBS) were all obtained from HyClone (Logan, UT, USA). The Cell Counting Kit-8 was obtained from Dojindo (Kumamoto, Japan). The Annexin V-FITC/PI detection kit was obtained from Abbkine (Wuhan, China). The Mycoplasma Stain Kit was obtained from Sigma Aldrich (Saint Louis, MO, USA), the TruSeqTM RNA sample preparation Kit was obtained from Illumina (San Diego, CA, USA), and the PrimeScript RT Reagent Kit was obtained from Beyotime Biotechnology (Shanghai, China). Unless otherwise stated, the other reagents used in this study were of the highest purity available.
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, total RNA was extracted with TRIzol and assessed by a spectrophotometer. Then, RNA from each group and 10 μl PCR reaction solution were added into 10 μl of the Prime Script RT Reagent Kit (Beyotime Biotechnology, Shanghai, China) for reverse transcription at conditions of 37°C (15 min) and 85°C (5 s). The primer was designed and synthesized by Shanghai Biotechnology Service Company in accordance with the gene sequence in the GenBank gene sequence design, together with OLIGO v6.6. Sequences are shown in Table 1 . qPCR was performed using Premix Ex Taq SYBR Green PCR (TaKaRa) according to the manufacturer's instructions on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA). The mRNA level of individual genes was normalized to GAPDH and calculated by the 2−ΔΔCT data analysis method.
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA from human tissues was extracted using the TRIzol reagent, and 1 μg of RNA was reverse transcribed into complementary DNA using the PrimeScript RT Reagent Kit (Beyotime, Shanghai, China). A quantitative real-time PCR was performed using the SYBR Green Mix (Beyotime, Shanghai, China) on an ABI Prism 7900 Sequence Detection System (ThermoFisher, CA, USA). By using the formula 2−△△Ct, we can quantify the expressions of OTUB2 and KRT80. Each sample was run in triplicate. The primer sequences used in this study were in (Table S1 ).
7
Quantitative RT-PCR Analysis of Pain-related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol and assessed by spectrophotometer. Then, reverse transcription of RNA was performed using Prime Script RT reagent Kit (Beyotime Biotechnology, Shanghai, China). Primer was designed and synthesized by Shanghai Biotechnology Service Company in accordance with Gene sequence in GenBank Gene sequence design, together with Oligo v6.6 (Sequences as Table 1 ). qPCR was performed using Premix Ex Taq SYBR-Green PCR (Takara) according to the manufacturer’s instructions on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA). The mRNA level of individual genes was normalized to GAPDH and calculated by the 2−ΔΔCTdata analysis method.
Nucleotide sequences of primers used for RT-PCR amplification.
| Target gene | Forward primer | Reverse primer |
|---|---|---|
| TRPV1 | CAGCGAGTTCAAAGACCCAGAGAC | GGAGCAGAGCGATGGTGTCATTC |
| CGRP | ATCTGGTCCTTCCTCACACTGTCC | TCATCCGTCTTCAGCTTGGCATTC |
| NGF | CCAGCCTCCACCCACCTCTTC | GCTTGCTCCTGTGAGTCCTGTTG |
| Netrin-1 | CCTTCCTCACCGACCTCAACAATC | CTTCTTGCCGAGCGACAGAGTG |
| TGF-β | TGCGCCTGCAGAGATTCAAG | AGACAGCCACTCAGGCGTAT |
| VEGF | CACGACAGAAGGGGAGCAGAAAG | GGCACACAGGACGGCTTGAAG |
8
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue or cell samples were lysed with the TRIzol reagent (16,096,020, Thermo Fisher Scientific) for 10–30 min at room temperature. Total RNA content was extracted with the addition of phenol/chloroform, and RNase-Free DNase I was used to digest and extract RNA. The concentration and purity of the extracted RNA (260/280 = 1.8—2.0) were detected with a nucleic acid quantitative analyzer (ND-1000, NanoDrop Technologies Inc.). Next, 400 ng total RNA was reverse-transcribed into cDNA with PrimeScript RT Reagent Kit (D7168l, Beyotime, Shanghai, China). RT-qPCR was subsequently performed using SYBR® Premix Ex Taq™ II kits (RR820A, Takara). PCR primers were synthesized by Riobio Biotechnology Co., Ltd (Guangzhou, China). The specific sequences are illustrated in Additional file 4 : Table S4. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was adopted as internal reference control of mRNAs. The 2−ΔΔCT method was utilized to express the relative expression of the gene.
9
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells with TRIzol reagent (Invitrogen) following the manufacturer’s instructions. Then the total RNA was reversed into cDNA in accordance with the instructions of PrimeScript RT Reagent Kit (Beyotime, China), and quantitative real-time polymerase chain reaction (qRT-PCR) analysis was conducted using the SYBR PrimeScript RT-PCR Kit (TaKaRa) with ABI 7500 Real-Time PCR System (Agilent Technologies, USA). Primer sequences for PCR were listed as following:
GAPDH was used as the internal control. The target gene relative levels were analyzed by the 2−ΔΔCq method [24 (link)].
GAPDH was used as the internal control. The target gene relative levels were analyzed by the 2−ΔΔCq method [24 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!