5-Pregnen-3β-ol-20-one-16α-carbonitrile (#P0543) was purchased from Sigma-Aldrich (St. Louis, MO). Lipopolysaccharide (E. coli, #tlrl-pslta) was purchased from InvivoGen (San Diego, CA). The RNeasy Mini Kit (#74104) was obtained from Qiagen (Valencia, CA). A 96-well PCR plate, Roche PCR Master Mix (Roche Diagnostics), TaqMan® primer and probes for Cyp3a11 (FP: GGATGAGATCGATGAGGCTCTG, RP: CAGGTATTCCATCTCCATCACAGT) and cyclophilin (FP: GGCCGATGACGAGCCC, RP: TGTCTTTGGAACTTTGTCTGCA) were purchased from Sigma-Genosys (Houston, TX). A Mouse WG-6 v2.0 expression BeadChip Kit was obtained from Illumina (San Diego, CA). TaqMan® Gene Expression assays with primers and probes for mouse Elk1 (#Mm00468233_g1), Mef2 (#Mm01340842_m1), Nrf2 (#Mm00477784_m1), Pea3 (#Mm00476696_m1), Stat1 (#Mm01257286_m1), and Mycmax (#Mm00487804_m1) were obtained from Thermo Fisher Scientific (#4331182, Waltham, MA). The primers for the epigenetic markers Ezh2, DNMT1, DNMT3a, LSD1 and RunX3 were a kind gift from Dr. Moorthy from the Baylor College of Medicine, Houston, TX.
5 pregnen 3β ol 20 one 16α carbonitrile
Manufactured by Merck Group
Sourced in United Kingdom, United States, China
5-Pregnen-3β-ol-20-one-16α-carbonitrile is a chemical compound used in laboratory research. It is a synthetic steroid that can be utilized for various biochemical and scientific applications. The core function of this product is to serve as a research tool for scientific investigations, without any interpretation or extrapolation on its intended use.
Automatically generated - may contain errors
Lab products found in correlation
Rifampicin, by Merck Group (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Stat1, by Thermo Fisher Scientific (1 mentions)
Mousewg 6 v2.0 expression beadchip kit, by Illumina (1 mentions)
Iodoacetamide iaa, by Merck Group (1 mentions)
Trypsin gold, by Promega (1 mentions)
Dl dithiothreitol, by Merck Group (1 mentions)
Phenobarbital, by Merck Group (1 mentions)
β naphthoflavone, by Merck Group (1 mentions)
Fura 2 am, by Thermo Fisher Scientific (1 mentions)
Fluorophore conjugated secondary antibody, by Thermo Fisher Scientific (1 mentions)
Alexa 488 conjugated phalloidin, by Thermo Fisher Scientific (1 mentions)
Bovine thrombin, by Merck Group (1 mentions)
Actin sc 1615, by Santa Cruz Biotechnology (1 mentions)
Dimethyl sulfoxide (dmso), by Fujifilm (1 mentions)
Artemisinin, by Merck Group (1 mentions)
Nicardipine, by Merck Group (1 mentions)
5 protocols using 5 pregnen 3β ol 20 one 16α carbonitrile
1
Quantification of Transcription Factors
2
In Vitro Xenobiotic Metabolism Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5-Pregnen-3β-ol-20-one-16α-carbonitrile (PCN), phenobarbital (PB), β-naphthoflavone (βNF), rifampicin (RIF), 1,4-Bis-[2-(3,5-dichloropyridyloxy)]benzene,3,32,5,52-tetrachloro-1,4-bis(pyridyloxy)benzene (TCPOBOP), ethoxyquin (EQ), corn oil (CO), dl -dithiothreitol (DTT), and iodoacetamide (IAA) were purchased from Sigma (Dorset, UK). 2,3,7,8-tetrachloro-p-dioxin (TCDD) was purchased from Toronto Research Chemicals (Toronto, Canada). Trypsin Gold was purchased from Promega (Madison, WI).
3
Humanized PXR Transgenic Mouse Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bovine thrombin, rifampicin and 5-Pregnen-3β-ol-20-one-16α-carbonitrile (PCN) were purchased from Sigma-Aldrich. Collagen was obtained from Nycomed. CRP-XL was from Professor R. Farndale (University of Cambridge). SR12813 was from Abcam (Cambridge, UK). Primary polyclonal anti-PXR (sc25381), monoclonal anti-RXRα/β/γ (sc46659), 14-3-3 ζ (sc-293415) and actin (sc-1615) antibodies were from SantaCruz. Monoclonal anti-PXR (ab41930), primary phospho anti-Lyn (Y396) (ab226778), Syk (Y525/526) (ab58575) and LAT (Y200) (ab68139) antibodies were from Abcam. Primary phospho anti-Src (Y418) (#44-660 G) was from ThermoFisher Scientific. Primary phospho anti-PLCγ2 (Y1217) (#3871), VASP (S157 and S239) (#3111 and #3114) and PKC (#2261) were purchased from Cell Signalling Technologies. Anti-phospho-Tyr 4G10 (#05-321) antibody was from Millipore. Fluorophore conjugated secondary antibodies, Fura-2AM and Alexa-488 conjugated phalloidin were from Life Technologies. PE-Cy5 anti-CD62P antibody was from BD Biosciences. FITC-labelled anti-fibrinogen was from Dako. All other reagents were from previously described sources5 (link),6 (link). Humanised PXR transgenic mice [C57BL/6-Nr1i2tm1(NR1I2)Arte] were purchased from Taconic Biosciences (Denmank) and bred under licence at the bioresource unit of the University of Reading.
4
Characterization of Pyrethroid Standards
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The structure, source and purity of each of the eight pyrethroids and the authentic samples of their metabolites tested in the present study are shown in Fig. 1 and Table 1 . 5-Pregnen-3β-ol-20-one-16α-carbonitrile (PCN; >97% pure) and artemisinin (>97% pure) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and Tokyo Chemical Industry Co. Ltd. (TCI; Tokyo, Japan), respectively. Bezafibrate (BZF; >99.3% pure) and dimethyl sulfoxide (DMSO; >99.5% pure) were purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan).Table 1
Source and purity of pyrethroids and the metabolites used in this study.
| Compound | Source | Purity (%) |
|---|---|---|
| allethrin | Wako | >98.0 (for Pesticide Residue Analysis) |
| bioresmethrin | Wako | 95.0 (for Pesticide Residue Analysis) |
| cypermethrin | Wako | >96.0 (for Pesticide Residue Analysis) |
| deltamethrin | Wako | 99.0 (for Pesticide Residue Analysis) |
| fenvalerate | Wako | 99.0 (for Pesticide Residue Analysis) |
| cis-permethrin | Wako | 98.0 |
| trans-permethrin | Wako | 98.0 |
| phenothrin | Ehrenstorfer | 97.5 |
| 3-phenoxybenzyl alcohol (PBAlc) | Wako | 98.0 |
| 3-phenoxybenzyl aldehyde (PBAld) | Wako | 97.0 |
| 3-phenoxybenzoic acid (PBAcid) | Wako | 98.0 |
Wako: Wako Pure Chemical Industries, Ltd., (Osaka, Japan).
Ehrenstorfer: Dr. Ehrenstorfer GmbH (Augsburg, Germany).
5
Ginkgolide A and Flavonoid Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A standardized powder form of Ginkgolide A and flavonoids were purchased from National Institute for the Control of Pharmaceutical and Biological Products, China. 5-pregnen-3β-ol-20-one-16α-carbonitrile (PCN), lps, and nicardipine were purchased from Sigma-Aldrich. All other common reagents not listed were purchased from Sigma-Aldrich or other common vendors.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!