Nucleospin plasmid purification kit

Manufactured by Macherey-Nagel

Sourced in Germany

The Nucleospin Plasmid purification kit is a lab equipment product designed for the isolation and purification of plasmid DNA from bacterial cultures. The kit utilizes a silica-membrane technology to efficiently capture and purify plasmid DNA, which can then be used for various downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine ltx, by Thermo Fisher Scientific (2 mentions) Phusion dna polymerase, by New England Biolabs (2 mentions) Dpni, by New England Biolabs (1 mentions) Gel extraction kit, by Qiagen (1 mentions) Enzymes for molecular biology, by New England Biolabs (1 mentions) Expand high fidelity polymerase, by Roche (1 mentions) Kanamycin, by Merck Group (1 mentions) Smarter race cdna amplification kit, by Takara Bio (1 mentions) Pcr4 topo ta vector, by Thermo Fisher Scientific (1 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions) Nucleospin gel and pcr clean up kit, by Macherey-Nagel (1 mentions) Pgex 4t 1, by GE Healthcare (1 mentions) Bamhi, by Thermo Fisher Scientific (1 mentions) Nunc maxisorp plate, by Thermo Fisher Scientific (1 mentions) High pure pcr template preparation kit, by Roche (1 mentions) Nucleospin extract 2 kit, by Macherey-Nagel (1 mentions) Yeastmaker yeast transformation system 2, by Takara Bio (1 mentions) E coli dh5α competent cells, by Thermo Fisher Scientific (1 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions) Generuler 1 kb plus dna ladder, by Thermo Fisher Scientific (1 mentions)

13 protocols using nucleospin plasmid purification kit

Generating Recombinant Vesicular Stomatitis Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutations were introduced using a pair of self-complementary primers carrying the desired change. The cDNA clone was amplified for eighteen cycles using the high-fidelity Phusion DNA polymerase (New England Biolabs). To remove template DNA, amplification products were digested with DpnI (New England Biolabs), which selectively cuts methylated GATC sites. Products were used for transforming competent Escherichia coli cells by the rubidium chloride heat-shock method. Plasmid DNA was then purified using the Nucleospin Plasmid purification kit (Macherey-Nagel) and used for transfecting BHK-21 cells as previously described (Whelan et al. 1995;
Sanjuán, Moya, and Elena 2004 ). Briefly, young 90 per cent confluent BHK-21 cells were infected with a recombinant vaccinia virus expressing T7 RNA polymerase and then co-transfected with the full-length VSV cDNA clone and three helper plasmids encoding the P, L, and N proteins. Transfections were done using Lipofectamine LTX (Life Technologies), following manufacturer’s instructions. After 6 h, 25 µg/ml 1-β-D-arabinofuranosylcytosine was added to inhibit vaccinia replication. After 3–4 days, supernatants were tested for the presence of infectious VSV particles by the standard plaque assay, vaccinia virus was removed by filtration, and one additional VSV infection cycle was performed to reach sufficient titer.

Hernández-Alonso P., Garijo R., Cuevas J.M, & Sanjuán R. (2015). Experimental evolution of an RNA virus in cells with innate immunity defects. Virus Evolution, 1(1), vev008.

+ Open protocol

+ Expand

Molecular Cloning Protocols and Plasmid Construction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oligonucleotides used for plasmids construction and information about the construction strategies are available upon request. DNA manipulations were performed as described (Sambrook et al., 1989 ), or with the Getaway cloning system (Life Technologies) in the case of lentiviral vectors. Enzymes for molecular biology were obtained from New England Biolabs. Plasmids were purified with the Nucleospin plasmid purification kit (Macherey-Nagel 740422.10). Linear DNA was purified from agarose gels using the gel extraction kit from Qiagen. Polymerase chain reactions (PCRs) were performed with the Expand High Fidelity polymerase (Roche) and a TRIO-thermoblock (Biometra GmbH). Plasmids used are listed in Table 1. E. coli DH5α (Chan et al., 2013 (link)) was used to amplify plasmids. All plasmids generated in this work are available for non-commercial purposes under request.

Hernandez-Perez I., Rubio J., Baumann A., Girao H., Ferrando M., Rebollo E., Aragay A.M, & Geli M.I. (2023). Kazrin promotes dynein/dynactin-dependent traffic from early to recycling endosomes. eLife, 12, e83793.

+ Open protocol

+ Expand

Cloning and Expression of Fibulin-1D' Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fibulin-1D’ whole coding sequence was cloned into pEF4/V5-His version A (Invitrogen, Carlsbad Ca) plasmid using EcoR1 and Xba1 enzyme restriction sites. The N-terminus 195 bp coding fragment was amplified using primers containing EcoR1 and Nco1 enzyme restriction sites. The kozak sequence before the ATG start site was also added. The fibulin-1D’ carboxy-terminus 1443 bp fragment (bp 196-1637, starting at the splice junction in exon 4) was cloned with Nco1and Xba1 enzyme restriction sites. The plasmid was cut with EcoR1 and Xba1 restriction enzymes. The fibulin-1D’ 195 and 1443 fragments were cut with restriction enzymes EcoR1/Nco1 and Nco1/Xba1, respectively. Ligation of inserts and plasmid was performed and the ligated plasmid was transformed into JM109 bacterial cells. Transformed bacterial cultures were grown on agar containing 100 µg/ml of ampicillin. Positive clones were picked and grown in 4 ml of LB broth. The plasmid was purified from bacterial cultures using NucleoSpin Plasmid purification Kit (Macherey-Nagel, Germany) according to manufacture instructions. Purified plasmids were sequenced and their sequence verified. Expressed fibulin-1D’ protein has a 6X His tag at the carboxy terminus.

Twal W.O., Hammad S.M., Guffy S.L, & Argraves W.S. (2015). A Novel Intracellular Fibulin-1D Variant Binds to the Cytoplasmic Domain of Integrin Beta 1 Subunit. Matrix biology : journal of the International Society for Matrix Biology, 43, 97-108.

+ Open protocol

+ Expand

Heterologous Expression of proC in B. megaterium

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transformation of pHT01-proC plasmid into the B. megaterium ΔproC cells was confirmed through colony PCR based amplification of the bla gene using the primers mentioned in Table 2). The plasmid DNA was recovered from the transformed cells using Nucleospin plasmid purification kit (Macherey–Nagel, Germany), and PCR amplification of the proC gene was confirmed using gene specific primers. For expression analysis, the RNA content was extracted from B. megaterium wild type cells, B. megaterium ΔproC cells and B. megaterium ΔproC cells harbouring pHT01-proC plasmid (designated as B. megaterium pHT01-proC⁺). The cells were exposed to pH 4.5 for 1 h and 5 h prior to RNA extraction. RNA and 1st strand cDNA synthesis were performed as described in the previous section (see “qRT-PCR analysis of proC gene”). Expression of the proC gene was checked using quantitative real-time PCR, where the amplification of 16S RNA gene was used for normalization. Bacillus megaterium wild type cells exposed to pH 7.0 for similar duration were used as reference for qPCR analysis.

Goswami G., Hazarika D.J., Chowdhury N., Bora S.S., Sarmah U., Naorem R.S., Boro R.C, & Barooah M. (2022). Proline confers acid stress tolerance to Bacillus megaterium G18. Scientific Reports, 12, 8875.

+ Open protocol

+ Expand

Cloning and Sequencing of Codon-Optimized Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols

All candidate enzymes were ordered as DNA from Twist Bioscience (San Francisco, CA, USA) and subcloned and sequenced as previously described (43 (link), 44 (link)). Briefly, codon-optimized genes flanked by SapI sites were subcloned by fragment exchange (FX) cloning into the pBXC3H vector containing a C-terminal 6×His tag. The ligation reaction product was transformed into E. coli MC1061 cells, and clones were selected on LB agar (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract, 1% [wt/vol] NaCl, 1.5% [wt/vol] agar-agar) supplemented with kanamycin (50 μg/ml; Sigma-Aldrich). Plasmids were isolated using the NucleoSpin plasmid purification kit (Macherey-Nagel), and Sanger sequencing was used to confirm correct cloning.

Goris M., Puntervoll P., Rojo D., Claussen J., Larsen Ø., Garcia-Moyano A., Almendral D., Barbas C., Ferrer M, & Bjerga G.E. (2020). Use of Flavin-Containing Monooxygenases for Conversion of Trimethylamine in Salmon Protein Hydrolysates. Applied and Environmental Microbiology, 86(24), e02105-20.

+ Open protocol

+ Expand

Obtaining Full-length FTZ-F1 Sequence

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length sequence of FTZ-F1 was obtained with SMARTer™ RACE cDNA Amplification Kit (TaKaRa Bio). Reverse transcription of DNase treated total RNA from larvae or adult female was done using SMARTscribe according to the manufacturer’s protocol. 5’ and 3’ RACE on larval and adult female RACE-ready cDNA was done with universal and gene specific primers (S1 Table) in a first and nested PCR reaction using conditions specified by the manufacturer. PCR products were purified from agarose gels using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel), and cloned in a pCR^®4-TOPO TA^® vector (Invitrogen) in TOP10 Escherichia coli cells. Colony PCR was performed using MOD M13-primers with the following reaction conditions; 5 min denaturation at 95°C, 30 cycles of 30 seconds denaturation at 95°C, 30 seconds annealing at 55°C, and elongation at 72°C for 1 minute. Clones were grown o/n in 5 ml LB medium containing 100 μg/ml ampicillin and purified using NucleoSpin^® Plasmid Purification kit (Macherey-Nagel). Clones were sequenced using a BigDye^® Terminator v3.1 Cycle sequencing kit (Applied Biosystems). Sequences were analyzed and assembled using Gap4 from the Staden Package [36 (link)].

Brunet J., Eichner C, & Male R. (2021). The FTZ-F1 gene encodes two functionally distinct nuclear receptor isoforms in the ectoparasitic copepod salmon louse (Lepeophtheirus salmonis). PLoS ONE, 16(5), e0251575.

+ Open protocol

+ Expand

Generation of Recombinant Vesicular Stomatitis Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

A full length cDNA clone was linearly amplified for 18 cycles using a pair of self-complementary primers carrying the desired mutation and the high-fidelity Phusion DNA polymerase. To remove the template DNA, the product was treated with DpnI, which selectively digests methylated DNA. E. coli cells were then transformed by the rubidium chloride heat-shock method and plasmid DNA was purified using the Nucleospin Plasmid purification kit (Macherey-Nagel) and used for transfecting BHK-21 cells as described in previous works51 (link)52 (link). Briefly, young 90% confluent BHK-21 cells were infected with a recombinant vaccinia virus expressing T7 RNA polymerase, and then co-transfected with the full-length VSV cDNA clone and three helper plasmids encoding the P, L, and N proteins. Transfections were carried out using Lipofectamine LTX (Life Technologies), following manufacturer’s instructions. After 6 h, 25 μg/mL 1-β-D-arabinofuranosylcytosine was added to inhibit vaccinia replication and, after 3–4 days, supernatants were tested for the presence of infectious VSV particles by the standard plaque assay. Vaccinia virus was removed by filtration and one additional blind infection was performed in BHK-21 to increase titer.

Garijo R., Cuevas J.M., Briz Á, & Sanjuán R. (2016). Constrained evolvability of interferon suppression in an RNA virus. Scientific Reports, 6, 24722.

+ Open protocol

+ Expand

Cloning and Purification of Pygsuia rquA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Pygsuia rquA gene was amplified from cDNA using primers designed with BamHI restriction enzyme recognition sites near their 5’-ends (Pb-rquA-forward CCGGATCCATGAATTCTTTAAGAATTAC and Pb-rquA-reverse CCCGGATCCTGCAATGCGGTGTGCAACAACC; restriction enzyme recognition sites are underlined). The amplicons were purified and cloned into the sequencing vector pCR4 (Life Technologies, Carlsbad, California) by TA-cloning. Plasmids (pCR4-Pb-rquA) were purified from transformed E. coli using the Nucleospin plasmid purification kit (Machery Nagel, Germany) and screened for correct sequence (Genewiz, South Plainfield, New Jersey). Destination plasmid pGEX-4T-1 (GE healthcare, Chicago, Illinois ) and pCR4-Pb-rquA were digested with BamHI (ThermoFisher, Waltham, Massachusetts). Fragments were purified using the Extract II kit (Machery Nagel) and cloned by standard protocols to generate pGEX-Pb-rquA.

Stairs C.W., Eme L., Muñoz-Gómez S.A., Cohen A., Dellaire G., Shepherd J.N., Fawcett J.P, & Roger A.J. (2018). Microbial eukaryotes have adapted to hypoxia by horizontal acquisitions of a gene involved in rhodoquinone biosynthesis. eLife, 7, e34292.

+ Open protocol

+ Expand

Screening for Antigen-Specific VHH Antibodies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Selections were performed as described [16 (link)]. The first selection round involved a direct coating of NUNC maxisorp plates (Thermo fisher Scientific, Rochester, NY, USA) with 10, 5, or 2.5 µg of antigen, or a pre-capturing of 10 µg antigen with 2, 1, or 0.5 µg of coated 1H6 antibody (Abnova, Taipei, Taiwan). Phage-VHH (P-VHH) from the first round were produced and purified as described [22 (link)] and subjected to a second round of selection with 5, 2.5, or 1 µg of directly-coated antigen. Purified P-VHH were stored at −20 °C in PBS containing 10 % glycerol. TG1 E. coli cells were infected with phage-VHH from the second selection round and plated on LB/Agar containing ampicillin. Ninety-four randomly selected clones were tested as described [10 (link)]. As secondary antibody for the screening ELISA, we used HRP conjugated mouse anti M13 (GE Healthcare, Buckinghamshire, UK). VHH DNA was purified using the Nucleospin Plasmid purification kit (Macherey–Nagel, Duren, Germany) according to manufacturer’s instructions. DNA was sequenced using primer M13REV (CAGGAAACAGCTATGAC). DNA to protein conversion: http://www.bioinformatics.picr.man.ac.uk/research/software/tools/sequenceconverter.html. VHH sequence alignment: http://www.ebi.ac.uk/Tools/msa/clustalW2.

Schut M.H., Pepers B.A., Klooster R., van der Maarel S.M., el Khatabi M., Verrips T., den Dunnen J.T., van Ommen G.J, & van Roon-Mom W.M. (2014). Selection and characterization of llama single domain antibodies against N-terminal huntingtin. Neurological Sciences, 36(3), 429-434.

+ Open protocol

+ Expand

Purification and Cloning of D. radiodurans DR_0049

Check if the same lab product or an alternative is used in the 5 most similar protocols

D.radiodurans genomic DNA was purified using High Pure PCR Template Preparation Kit (Roche applied science) with cell lysis in the supplied tissue lysis buffer. The D. radiodurans open reading frame DR_0049 was PCR amplified from genomic DNA: 50 µL PCR contained 120 ng DNA, 0.5 µM of each of the primers CTATCTTCGCCATATGTCCGC and CACCCTGAAAAAGATCTGTCCATC, 200 µM of each dNTP, 1 unit Phusion DNA polymerase (New England Biolabs), 6 % DMSO and 1× Phusion GC buffer. The PCR temperature cycling was: 98 °C/60 s; 30 × (98 °C/5 s, 57 °C/15 s, and 72 °C/45 s); and 72 °C/600 s. The desired PCR product was purified via agarose gel electrophoresis using the NucleoSpin Extract II kit (Macherey–Nagel) with AE buffer from NucleoSpin Plasmid Purification kit (Macherey–Nagel). The PCR fragment was digested with restriction enzymes NdeI and BglII (cleavage sites present in the PCR primers) and inserted into the expression vector pLJ102 as previously described (Andersen and Douthwaite 2006 (link)), generating an isopropyl-1-thio-β-D-galactopyranoside (IPTG)-inducible construct for the recombinant protein with a C-terminal histidine₆ tag. This plasmid—named pLJ102-DR0049—was subsequently transformed into E. coli strain Top10 with selection for ampicillin resistance.

Mundus J., Flyvbjerg K.F, & Kirpekar F. (2015). Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA. Extremophiles, 20, 91-99.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!