Chromo4 detection system

Quantitative real-time PCR (qRT-PCR) analysis was performed for plant materials taken from the location of Harbin on May 20, 2012 when the day length was 16.10 hr. The cultivars were performed for qRT-PCR at this location were star (*) marked in the accession column in Table S1. The upmost fully expanded leaves from the apical meristem were sampled from 2.5 to 3 hr after dawn, 14 days after emergence. Total RNA was extracted using TRIzol (Life Technologies) method. The isolated RNA was then subjected to reverse transcription using the SuperScript III Reverse Transcriptase kit. Quantitative real-time PCR was performed on each cDNA sample with the SYBR Green Master Mix (TransStart Top Green qPCR SuperMix) on Bio-Rad Chromo4 Detection System according to the manufacturer's protocol. The measured Ct values were converted to relative copy-numbers using the ΔΔCt method. Amplification of TUA5 (Glyme05g29000.1) was used as an internal control to normalize all data. E1 expression level of Kariyutaka was used as a reference. Primers used were TUA5-F 5′-TGCCACCATCAAGACTAAGAGG and TUA5-R 5′-CTCTAATGGCGGCATCAAG; E1-F 5′–CACTCAAATTAAGCCCTTTCA and E1-R 5′- TTCATCTCCTCTTCATTTTTGTTG; Three fully independent biological replicates were obtained and subjected to real-time PCR run in triplicate. Raw data were standardized as described previously [35] (link).

Total RNA was isolated from powdered tissue homogenates using TRIzol Reagent according to the manufacturer’s instructions, and purified using the RNeasy MinElute Cleanup Kit to attain an A₂₆₀/A₂₈₀ ratio between 1.9 and 2.0. First-strand cDNA, synthesized from 1 μg RNA using the RT² First Strand kit, was used in a custom PCR array comprising 96-well plates pre-coated with primers listed in Table 1. Quantitative real-time PCR was conducted using a Chromo4 Detection system (Bio-Rad Laboratories Canada Ltd., Mississauga, ON, CA) according to cycling conditions outlined by the PCR array manufacturer. Data were analysed using RT² Profiler PCR Array Data Analysis software (Version 3.5; QIAGEN Inc.) and normalized to GAPDH mRNA expression. Adiponectin mRNA expression (forward: 5′-GCAGAGATGGCACTCCTGGA-3′; reverse: 5′-CCCTTCAGCTCCTGTCATTCC-3′) was analyzed by quantitative real-time PCR using DyNAmo HS SYBR Green qPCR kit (Finnzymes, Woburn, MA) with a Chromo4 Detection system and the following cycling conditions: Hot start: 95°C for 15 min; 35 cycles of: 95°C for 30 s, 65°C for 30 s, 72°C for 30 s; final extension: 72°C for 10 min.

Serial 2-fold dilutions (1- to 16-fold) of DNA samples from both cysts and vegetative cells were used to construct the standard curves using triplicate measurements from real-time PCR. The sequences of the H. akashiwo-specific PCR primers are shown in Table 1. This primer set targets the species-specific internal transcribed spacer 2 region located between the 5.8S and 28S rRNA genes. This primer pair is specific to H. akashiwo and does not react to other algal species [33 ].
The EvaGreen Real-Time PCR assays contained 7.5 μL 1× SsoFast™ EvaGreen^® Supermix (Bio-Rad, CA, USA), 0.25 μM primer set, 2 μL genomic DNA (~0.1 μg), and double-distilled water in a final volume of 15 μL. The qPCR reactions were performed using a Chromo4 Detection System (Bio-Rad, USA) at 98°C for 3 min, followed by 39 cycles at 98°C for 7 s and 62.5°C for 10 s. After denaturation, the melt curves were monitored from 65°C to 95°C in 0.5°C increments using a 10 s hold at each step. All sediment DNA samples were analyzed by qPCR, and standard curves were generated using the same PCR conditions as described above.
The slope of standard curves were used to calculate PCR efficiency using the following equation: E = 10^(-1/s)-1, where E is the PCR efficiency, s is the slope of standard curves.