The largest database of trusted experimental protocols

36 protocols using lentivirus

1

CD44 Gene Silencing in Cholangiocarcinoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CD44 genes in KKU-213 and KKU-156 cells were silenced using lentivirus (Sigma-Aldrich) containing shRNAs for human CD44. Briefly, 1.6 x 104 cells of KKU-213 and KKU-156 were seeded into a 48-well plate. A lentiviral construct was then transduced into the cell lines with DMEM containing hexadimethrine bromide (Sigma-Aldrich). A lentivirus containing shRNAs for a non-targeting gene was used as a control (Sigma-Aldrich). After 24 h transduction, KKU-213 and KKU-156 cells were treated with 1 μg/ml of puromycin (Sigma-Aldrich) for two weeks to establish stable clones of CD44 KD, and the expression of CD44 was confirmed using flow cytometry.
+ Open protocol
+ Expand
2

Lentiviral vector-mediated ASS expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus expressing full-length rats argininosuccinate synthetase (ASS) cDNA and Lentivirus containing empty plasmids (vector) were constructed by Sigma-Aldrich (St. Louis, MO). In addition, Lentivirus carrying shRNA against ASS and Lentivirus containing nonspecific ASS (scramble) were also constructed by Sigma-Aldrich. After cleaning, the rats were injected with the recombinant vector using a 31 G needle. No toxic effects were found after treatment with the lentiviral vector.
+ Open protocol
+ Expand
3

Establishing TRPC6-overexpressing Podocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TRPC6-overexpressing plasmid was constructed by cloning the full length of the CDS of TRPC6 gene (Kingsley biological co, LTD) into EcoRI/BamHI sites of pCDH-GFP-PURO vector (System Biosciences, Palo Alto, CA, USA). The plasmids were packaged into lentivirus (Shanghai GeneChem. CO., Ltd, Shanghai, China) in HEK 293T packaging cells (Shanghai GeneChem. CO., Ltd). In brief, MPC5 podocytes were seeded in 6-well plates (1.0×105) and incubated with polybrene (6 μg/mL; Sigma-Aldrich, St. Louis, MO, USA) in combined with lentivirus containing TRPC6-overexpressing plasmid (multiplicity of infection of 10 to 30) or blank lentivirus vector as a negative control (NC). Positive cells were selected for in RPMI-1640 containing 1 μg/mL puromycin until the purity of TRPC6-overexpressing cells reached 80%. The TRPC6 stable cell line was confirmed using TRPC6 protein and mRNA expression, and was used for further experiments. MPC5 podocytes were divided into the TRPC6 group (expressing lentivirus containing TRPC6-overexpressing plasmid) or the NC group (containing blank lentivirus vector).
+ Open protocol
+ Expand
4

Lentiviral Transduction of hPSC-CMs

Check if the same lab product or an alternative is used in the 5 most similar protocols
On day 12 of the differentiation, H1 hPSC-CMs were reseeded in 24 well plates. The next day, cells were treated with 100 μl lentivirus and 8 μg/ml polybrene (Millipore). After two days, 50 μg/ml hygromycin or 1 μg/ml puromycin containing the media was added to cells. After one week of treatment, cells were assayed for calcium handling, cell size, or ATP generation.
+ Open protocol
+ Expand
5

SARS-CoV-2 Spike Protein Lentivirus Mimic

Check if the same lab product or an alternative is used in the 5 most similar protocols
Spike S1 (40591-V08H; Sino Biological) was conjugated to lentivirus (Cellomics Technology LLC) to create a SARS-CoV-2 mimic. His-tagged Spike S1 was linked to Ni nitrilotriacetate (Ni-NTA) through the chemical interaction. NTA with mercapto group (N-[Nα,Nα-Bis(carboxymethyl)-L-lysine]-12-mercaptododecanamide) was first reacted with 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester sodium salt (Sulfo-SMCC) to give NTA-SMCC and then was added to the lentivirus. The NTA groups were conjugated to the lentivirus through the −NH2 group on lentivirus and N-hydroxysuccinimide ester on NTA-SMCC. The free NTA-SMCC was removed by centrifugation using an ultrafiltration tube (100 kDa MWCO; Millipore) to give SARS-CoV-2 mimicking virus (Spike S1-lentivirus). The successfully conjugated Spike S1 on lentivirus was confirmed using TEM. Briefly, SARS-CoV-2 mimics were incubated with anti-Spike S1 antibodies overnight at 4°C. Free antibodies were removed using an ultrafiltration tube (100 kDa MWCO; Millipore) and washed with PBS three times. Spike S1 on the SARS-CoV-2 mimics was labeled with immunogold (10 nm) antibodies and negatively stained for TEM visualization. The conjugation efficiency of Spike S1 on lentivirus was determined using ELISA (Sino Biological SARS-COV-2 SPIKE ELISA KIT, Sino Biological) according to manufacturer’s protocol.
+ Open protocol
+ Expand
6

SARS-CoV-2 Spike Protein Lentivirus Mimic

Check if the same lab product or an alternative is used in the 5 most similar protocols
Spike S1 (40591-V08H; Sino Biological) was conjugated to lentivirus (Cellomics Technology LLC) to create a SARS-CoV-2 mimic. His-tagged Spike S1 was linked to Ni nitrilotriacetate (Ni-NTA) through the chemical interaction. NTA with mercapto group (N-[Nα,Nα-Bis(carboxymethyl)-L-lysine]-12-mercaptododecanamide) was first reacted with 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester sodium salt (Sulfo-SMCC) to give NTA-SMCC and then was added to the lentivirus. The NTA groups were conjugated to the lentivirus through the −NH2 group on lentivirus and N-hydroxysuccinimide ester on NTA-SMCC. The free NTA-SMCC was removed by centrifugation using an ultrafiltration tube (100 kDa MWCO; Millipore) to give SARS-CoV-2 mimicking virus (Spike S1-lentivirus). The successfully conjugated Spike S1 on lentivirus was confirmed using TEM. Briefly, SARS-CoV-2 mimics were incubated with anti-Spike S1 antibodies overnight at 4°C. Free antibodies were removed using an ultrafiltration tube (100 kDa MWCO; Millipore) and washed with PBS three times. Spike S1 on the SARS-CoV-2 mimics was labeled with immunogold (10 nm) antibodies and negatively stained for TEM visualization. The conjugation efficiency of Spike S1 on lentivirus was determined using ELISA (Sino Biological SARS-COV-2 SPIKE ELISA KIT, Sino Biological) according to manufacturer’s protocol.
+ Open protocol
+ Expand
7

Knockdown and Overexpression of Rab27a and CDX2 in GC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HGC-27 cells were seeded in 6-well plates at 2 × 105 cell/mL for 24 h and transduced with lentivirus (Sigma; a titer of 108 TU/mL) carrying short hairpin RNA (sh-) Rab27a and the control sh-NC. After 72 h, the medium was replaced with medium containing 4 μg/mL puromycin, and cell culture continued for at least 14 days. Puromycin-resistant cells were amplified in medium containing 2 μg/mL puromycin for 9 days and then transferred to puromycin-free medium to obtain HGC-27 cells with stable knockdown of Rab27a. shRNA sequences are detailed in Additional file 1: Table S2.
Using Lipofectamine 2000 reagent (11,668–019, Invitrogen, Thermo Fisher Scientific), GC cells at passage 3 were transfected with plasmids (Guangzhou RiboBio Co., Ltd., Guangzhou, Guangdong China) of overexpression (oe)-CDX2 (constructed by pEXP-RB-Mam [R11091.1, RiboBio] plasmid vector), oe-NC, sh-H19-1 (lnc3160303052832), sh-H19-2 (lnc3180507021406) and sh-NC (lnc3N0000001-1–5). After 48 h, RNA and protein were extracted for subsequent experiments.
+ Open protocol
+ Expand
8

Lentiviral Transduction of Prostate Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ultrahigh titre of lentivirus from CD511B-1 + miR-183FC and CD511B-1 scrambled control was produced by Systems Biosciences (Mountain View, CA) and used to transduce RWPE-1, RWPE-2, and PrE cells by spinfection45 (link) via UIC Institutional Biosafety Committee approved protocol (#15–020). Briefly, lentivirus (120 MOI) and polybrene (8 μg/ml) (Sigma Aldrich St. Louis, MO) were added to 75,000 cells in a polystyrene tube, incubated 1hr 37 °C, centrifuged at 750 × g 25 °C for 1hr and re-plated. GFP expression was evident at 72hr using EVOS fluorescence microscope (ThermoScientific). PC-3 with knockdown of the miR-183 family were generated using the miRZIP Lentivector-based Anti-miR system (System Biosciences, Palo Alto, CA), with shRNA targeted to miR-183 or control scrambled shRNA, and maintained under selection with 1.5 μg/ml puromycin.
+ Open protocol
+ Expand
9

Cardiomyocyte membrane imaging and actin modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
For rescue experiments, after 2 h plating, Bin1 HT cardiomyocytes were infected with GFP or BIN1 isoform overexpressing adenovirus (MOI 1000) overnight for live-cell membrane imaging with Di-8-ANNEPS or fixed in 4% PFA and labeled with Alexa647 conjugated WGA for fixed cell membrane imaging. For Bin1 knockdown experiments, cardiomyocytes were infected with (MOI 5) control, constitutive exon 2 BIN1 shRNA (5’–CCGGAGACGAAGGACGAGCAGTTTGCTCGAGCAAACTGCTCGTCCTTCGTCTTTTTTG - 3’), or exon 13 targeting BIN1 shRNA (5’ –CCGGTGACGCATTTGTCCCTGAGATCTCGAGATCTGCAGGGACAAATGCGTCATTTTTG - 3’) expressing lentivirus (Sigma) overnight. Post-viral infection, cardiomyocytes were cultured for 3 d before fixation for WGA labeled membrane intensity study. For actin experiments, fresh isolated cardiomyocytes were plated for 2 h, treated with 1 µM latrunculin A or 10 µM cytochalasin D overnight, and followed by PFA fixation and T-tubule labeling with Alexa647-conjugated WGA50 (link).
+ Open protocol
+ Expand
10

Silencing Mdh2 and Tet2 in mPDCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To silence Mdh2, mPDCs were transduced, in the presence of 8μg/ml polybrene (Sigma-Aldrich, Diegem, Belgium) with a lentivirus carrying the gene-targeting shRNA (Sigma-Aldrich) the day after isolation. A lentivirus containing an empty vector (Sigma-Aldrich) was used as negative control. To silence Tet2, cells isolated from Tet2fl/fl mice and wild-type (Tet2wt/wt) littermates were transduced with a lentivirus carrying a Puro.Cre empty vector (Addgene, Watertown, MA, USA). After 72h, puromycin (2μg/ml; InvivoGen, San Diego, CA, USA) was added to the culture medium for 48h. Sequences of the shRNAs are listed in Table S2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!