Mouse anti v5 tag

Rabbit anti-acetyl-α-tubulin (Lys40) (D20G3) (#5335; Cell Signaling), chicken anti-GFP (ab13970; Abcam), mouse anti-Pyruvate dehydrogenase E2/E3bp (ab110333; Abcam), goat anti-TRPP2 (G-20; Santa Cruz Biotechnology), rabbit anti-V5 epitope tag (Merck Millipore), and mouse anti-V5-Tag (Clone SV5-Pk1; Bio-Rad) antibodies were obtained commercially. Monoclonal anti-TRPP2^698–799 antibodies and the anti-Amo antiserum have been described previously [12 (link),58 (link)]. Western blot detection was performed using an anti-mouse (Dako) or anti-rabbit (GE Healthcare) horseradish peroxidase–coupled secondary antibody. Antigens were visualized by immunofluorescence using secondary goat anti-chicken Alexa 488 (Invitrogen), donkey anti-mouse Alexa 488 (Invitrogen), donkey anti-rabbit Alexa 488 (Invitrogen), and donkey anti-mouse Cy3 (Jackson Immunoresearch) antibodies.

Cells grown in six-well plates were transfected with endotoxin-free pcDNA6 SH-V5/His or the control plasmid pcDNA6-GFP (Invitrogen) using Lipofectamine 2000 Reagent (Invitrogen) following the manufacturer’s instructions. Twenty-four hours after transfection, the media were refreshed and, in some cases, 1 µg of LPS (K12, Invivogen) and/or rTNF-α were added to cells for 1 h. Cells were harvested and lysed into 150 µl of SDS sample buffer (Bio-Rad). Expression of the SH gene was confirmed by Western blot using mouse anti-V5 Tag (Serotec) and mouse anti-Histidine Tag (Serotec). Primary bovine CD14⁺ cells were electroporated in an Amaxa’s Nucleofector using a Human Monocyte Nucleofector Kit.

The presence of antibodies to individual proteins was determined using indirect immunofluorescence. Sera were used at a single dilution of 1:100 and incubated with Vero cells transfected with each of the individual genes fused to a V5 tag. Pre-immunization and pre-challenge sera were tested from pigs immunized with the pools of viral vectors expressing ASFV ORFs. Only pre-challenge sera from pigs immunized with the control antigens were analyzed for antibodies to ASFV proteins. Mouse anti-V5 tag (AbD Serotec, Oxford, UK. MCA1360) diluted 1:1000 was used as a positive control for V5 fusion gene expression. In indirect immunofluorescence, the anti-V5 antibody was incubated simultaneously with the animal sera on transfected cells. Secondary antibodies were goat anti-mouse IgG (H+L)-AF594 (Thermo Fisher, Hemel Hempstead, UK) and goat anti-porcine IgG (H+L)-AF488 (Southern Biotech, Birmingham, UK), all added at a dilution of 1:1000 to the cells. The cells were then observed under the fluorescence microscope and screened for simultaneous green and red fluorescence, resulting from recognition by specific antibodies in the pig serum of the expressed viral protein and the presence of the V5 tag respectively.

RNA was extracted from cells using the Qiagen RNeasy mini kit. cDNA was synthesised using Superscript II reverse transcriptase with oligo(dT)-anch [27 (link)] as the primer. Real-time quantitative PCR of PPRV N mRNA or host cell L13A mRNA was carried out essentially as previously described [18 (link),27 (link)], using a set of primers recognising the PPRV N gene and optimised for SYBR Green-based qPCR (NF2b:CGGGTTGACCTTTGCATCA and NREVb: CTTTGTTGTGTGTATTTAACCCACCTT). Confocal microscopy was performed as previously described [22 (link)]. Mouse anti-V5 tag was obtained from AbD Serotec and AlexaFluor 568 anti-mouse IgG was from Life Technologies. All images were taken by sequential scanning and the resulting separate colour images overlayed in Photoshop. cELISA antigen was prepared as previously described [16 ]. SDS-PAGE and Western blots were carried out as previously described [28 (link)], except that the Western blot transfer was performed using a TransBlot SD Semi Dry Electrophoretic Transfer Cell (Bio-Rad) and Bjerrum and Schafer-Nielsen transfer buffer (48 mM Tris, 39 mM glycine, 37.5 mg/L SDS, 20% methanol, pH 9.2) [29 ]. Statistical analysis was performed in Minitab v17.