Precast NuPAGE 4-12% Bis-Tris polyacrylamide protein gels were purchased from Invitrogen. Protein gels were run at 200 V for 35 minutes in MES buffer, gels were then washed 9 times with warm water, stained with coomassie blue for 4 hours. It was then destained using tap water for 16 hours before we imaged them on Bio-Rad ChemiDoc MP imaging System. All protein bands were analyzed and quantified using Imagelab 5.2.1. Agarose DNA gels were made in house using 1% UltraPure Agarose 1000 in TAE buffer with 0.01% EZ-Vision (Amresco), DNA gels were run at 150 V for 25 minutes and visualized under UV.
Ez vision
Manufactured by Avantor
Sourced in United States
EZ-Vision is a compact and easy-to-use DNA/RNA visualization system. It is designed for the detection and analysis of nucleic acids in agarose gels.
Automatically generated - may contain errors
Lab products found in correlation
Nupage 4 12 bis tris protein polyacrylamide gels, by Thermo Fisher Scientific (2 mentions)
Chemidoc mp imaging system, by Bio-Rad (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Ezdnase, by Thermo Fisher Scientific (2 mentions)
Superscript 4 kit, by Thermo Fisher Scientific (2 mentions)
Gotaq g2 hot start pcr kit, by Promega (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Directpcr lysis reagent, by Viagen Biotech (1 mentions)
Prism 7, by GraphPad (1 mentions)
Hhai restriction enzyme, by New England Biolabs (1 mentions)
Advantage cdna pcr kit, by Takara Bio (1 mentions)
Pulse field certified agarose, by Bio-Rad (1 mentions)
Agarose gel electrophoresis, by Avantor (1 mentions)
Lambda maxi kit, by Qiagen (1 mentions)
Imagequant las 400, by GE Healthcare (1 mentions)
Pcr buffer, by Qiagen (1 mentions)
Sars cov 2 synthetic rna control 2 wuhan hu 1, by Twist Bioscience (1 mentions)
17 protocols using ez vision
1
Protein and DNA Gel Electrophoresis
2
Analysis of SLC9A3 and GAPDH Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from normal adult human and rat tissues were obtained from Xing-Yi Biotechnologies Company (Taipei, Taiwan), and 10 μL of RNA was used to generate cDNA at 55°C using Superscript III RT enzymes (Invitrogen, Breda, Netherlands) in a final volume of 20 μl. Targets were amplified over 30 cycles of denaturation at 95°C for 1 min, annealing for 1 min, and extension at 72°C for 1 min, followed by final extension at 72°C for 5 min. PCR products were mixed with 10% EZ vision (Amresco Inc., Solon, OH, USA) and analyzed by electrophoresis on a 2% agarose gel. The four primers used to amplify human SLC9A3, human GAPDH, rat Slc9a3, and rat Gapdh were as follows:
SLC9A3, 5-GGAGTCCTTCAAGTCGACCA-3′ and 5′-AAGAAGGTGCCGGGAGAGTAG-3′; Slc9a3, 5′- ACCCCGCCCATCTACAGT -3′ and 5′- CACAGAAGCGGAGGAATAGC -3′; GAPDH, 5′-TGGCGTCTTCACCACCAT-3′ and 5′-CACCACCCTGTTGCTGTA-3′; and Gapdh, 5′- TCAACGGGAAACCCATCA -3′ and 5′- TGATGGGTGTGAACCACGAG -3′
SLC9A3, 5-GGAGTCCTTCAAGTCGACCA-3′ and 5′-AAGAAGGTGCCGGGAGAGTAG-3′; Slc9a3, 5′- ACCCCGCCCATCTACAGT -3′ and 5′- CACAGAAGCGGAGGAATAGC -3′; GAPDH, 5′-TGGCGTCTTCACCACCAT-3′ and 5′-CACCACCCTGTTGCTGTA-3′; and Gapdh, 5′- TCAACGGGAAACCCATCA -3′ and 5′- TGATGGGTGTGAACCACGAG -3′
3
Genotyping Mouse DJ-1 and Crb1 rd8 Mutations
4
Protein and DNA Gel Electrophoresis
5
Visualizing ssDNA-Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ΔN-RadAi, ΔN-RadAi-AA, ΔN-RadAi-R503A, and free intein were incubated with M13mp18 ssDNA for 1 h at 63°C in four parts TE with one part RSB. An equal volume of 83% glycerol and 2× EZ Vision (Amresco) was added and run on 1% agarose gels in 1× Tris-acetate-EDTA at the ssDNA and protein concentrations indicated. ssDNA was visualized under UV light. Apparent Kd values were calculated using Prism7 (GraphPad), accounting for ligand depletion.
6
SLC24A5 SNP Genotyping via PCR-RFLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The forward and reverse primers for PCR amplification of the SNP region (rs1426654) in the SLC24A5 gene are described in S6 Table . The A>G change creates a new HhaI restriction site. DNA was PCR amplified using Advantage cDNA PCR Kit (Clontech Laboratories, Mountain View, CA) and then digested with HhaI restriction enzyme from New England BioLabs Inc. (Ipswich, MA) as per their instructions. The PCR products were resolved on a 2% agarose gel. The PCR bands in the gel were visualized with EZ-Vision (Amresco, Solon, OH) and UV light and photographed. The digested DNA showed two bands of 71 and 100 bps and the undigested showed a band of 171 bps (S1 Fig ).
7
Genetic Profiling of Listeria monocytogenes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genetic profile of L. monocytogenes isolates was subjected to DNA profiling using the restriction enzymes AscI and ApaI (Thermo Fisher Scientific, USA). It was then identified by electrophoresis using the CH-DR II (Bio-Rad Inc, Hercules, CA, USA) system according to the PFGE PulseNet protocol (CDC 2017). After the digestion of DNA in the prepared plugs, they were subjected to electrophoresis in 1% (w/v) Pulse Field Certified Agarose (BioRad). The values of the electrophoretic parameters used were: initial running time, 4.0 s; final running time, 40.0 s; total time 22 h; angle, 120°; 6.0 V/cm; temperature, 14°C; ramp factor, linear. The PFGE gels were stained with EZ-Vision (Amresco Inc., USA) for 30 minutes after electrophoresis. They were then destained with deionized water twice for 15 min. Phylogenetic dendrograms were drawn using BioNumerics 7.6 (Applied Maths, Belgium) with the Unweighted Pair Group Method and Arithmetic Mean (UPGMA) method (Dice similarity coefficient, 1.5% band tolerance, 0.5% optimization and 80% degeneracy cutoff value).
8
Standardized Genotyping PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The conventional PCR described by Chironna et al. (2011) (link) was standardized for genotyping. This PCR amplifies a region of 217 bp; this region includes positions 2063 and 2064, which contain 95% of the mutations present in this region of the gene. In contrast to the protocol described by the author, the annealing temperature of the primers used in the present study was 58.2 °C.
All products of the PCR reactions were developed by 2.5% agarose gel electrophoresis (Amresco, Solon, OH, USA) stained with EZ-VISION (Amresco), in a run for 60 min at 70 V. The size of the band observed was confirmed to correspond approximately to the size of the expected fragment.
The intra- and inter-assay reproducibility of the PCR protocols was assessed. The presence of inhibitors was excluded for PCR reactions yielding negative results by the amplification of a fragment of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific).
All products of the PCR reactions were developed by 2.5% agarose gel electrophoresis (Amresco, Solon, OH, USA) stained with EZ-VISION (Amresco), in a run for 60 min at 70 V. The size of the band observed was confirmed to correspond approximately to the size of the expected fragment.
The intra- and inter-assay reproducibility of the PCR protocols was assessed. The presence of inhibitors was excluded for PCR reactions yielding negative results by the amplification of a fragment of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific).
9
Genomic DNA Isolation and Sequencing of Phages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phage Team1-SA812, Team1-SMQ121, 812-SA812, 812-SMQ121, K-SA812, and K-SMQ121 genomic DNAs were isolated using a Lambda Maxi kit (Qiagen) with modifications reported elsewhere [34] (link). The EcoRV (Roche Diagnostics) restriction profile of the six phages were compared to confirm differences between phages Team1, phi812, and K, as well as identities with their respective derivatives amplified on the other strain. The DNA fragments were separated in a 0.8% agarose gel, stained with EZVision (Amresco), and photographed under UV illumination. The sequencing was performed using pyrosequencing technology on a 454 FLX instrument available at the Plateforme d'analyses génomiques of the IBIS. Reads were assembled into a single contig with 32-fold coverage for Team1-SMQ121 and 86-fold coverage for Team1-SA812. For phages phi812-SA812 and phi812-SMQ121, reads were assembled into a single contig with 32-fold and 71-fold coverage, respectively. Finally, for phages K-SA812 and K-SMQ121, the coverage was 72-fold and 62-fold coverage, respectively.
10
Detecting Cassava Mosaic Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The source plant for our work was the cultivar ‘Manioc de Table’. Fresh leaves were collected from the inoculated plants one month after grafting, and genomic DNA was extracted following the protocol described by Dellaporta et al. [15 ], with some modifications [16 (link)]. PCR analyses were performed using primers JSP1 and JSP2 (5′-ATGTCGAAGCGACCAGGAGAT-3′ and 5′-TGTTTATTAATTGCCAATACT-3′ , respectively) to detect ACMV, and JSP1 and JSP3 (5′-ATGTCGAAGCGACCAGGAGAT-3′ and 5′-CCTTTATTAATTTGTCACTGC-3′ , respectively) for detecting EACMV, following the protocol described by Pita et al. [17 (link)]. PCR products were visualized on 1.8% agarose gel using EZ-Vision (VWR International, Radnor, PA, USA) and visualized under UV light.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!