Lightcycler480 system

Manufactured by Thermo Fisher Scientific

Sourced in United States, China

The LightCycler480 System is a real-time PCR instrument designed for accurate and reliable quantification of nucleic acids. It features high-performance optics, precise temperature control, and a flexible software interface to support a variety of applications, including gene expression analysis, genotyping, and pathogen detection.

Automatically generated - may contain errors

Lab products found in correlation

30 protocols using lightcycler480 system

Transcriptomic Analysis of Stretched Skin

Check if the same lab product or an alternative is used in the 5 most similar protocols

The whole layer 5-day stretched skin and non-stretched skin were harvested for RNA-seq. RNAZol kit (Sigma-Aldrich) was used to extract total mRNA. The concentration of RNA was measured by Nanodrop spectrophotometer. Integrity of total RNA was assessed using Agilent 2200 TapeStation-RNA R6K assay (Agilent) and the high quality of RNA (RNA Integrity Number, RIN ≥ 7.5) were used. RNA-seq cDNA libraries were constructed following the standard Illumina protocol. The cDNA libraries were quantitatively measured by qRT-PCR (Roche LightCycler® 480 system) and Qubit Fluorometer (Invitrogen, Carlsbad, California, USA). The cDNA libraries were pooled and sequenced on an Illumina NextSeq 500 platform in single-ended with 76 bps.

Chu S.Y., Chou C.H., Huang H.D., Yen M.H., Hong H.C., Chao P.H., Wang Y.H., Chen P.Y., Nian S.X., Chen Y.R., Liou L.Y., Liu Y.C., Chen H.M., Lin F.M., Chang Y.T., Chen C.C, & Lee O.K. (2019). Mechanical stretch induces hair regeneration through the alternative activation of macrophages. Nature Communications, 10, 1524.

+ Open protocol

+ Expand

RNA-Seq Analysis of hPSCs on Stiffness Substrates

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA samples were extracted using TRIzol (Invitrogen, Carlsbad, CA) from hPSCs cultured on substrates of different stiffnesses. Following deoxyribonuclease I enzyme treatment, the RNA integrity number (RIN) was assessed using an Agilent 2200 TapeStation-RNA R6K Bioanalyzer (Agilent Technologies), and the high quality of RNA (RIN ≥ 8.8) was used. RNA-seq complementary DNA (cDNA) libraries were constructed following the standard Illumina protocol and validated using the Agilent 2200 TapeStation-D1000 assay (Agilent Technologies). cDNA libraries were quantitatively measured by qRT-PCR (Roche LightCycler 480 system) and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA). The cDNA libraries were induced and sequenced on an Illumina NextSeq 500 platform in single-ended mode with 75 bp.

Chen Y.F., Li Y.S., Chou C.H., Chiew M.Y., Huang H.D., Ho J.H., Chien S, & Lee O.K. (2020). Control of matrix stiffness promotes endodermal lineage specification by regulating SMAD2/3 via lncRNA LINC00458. Science Advances, 6(6), eaay0264.

+ Open protocol

+ Expand

Quantitative Real-Time PCR and RNA Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

qRT-PCR was performed as previously reported [16 (link)]. Briefly, scar-derived fibroblasts were collected after 72 h of incubation with different treatments, and rabbit scars were harvested on day 35 post-operation. Total RNA was extracted using an RNA isolation kit (Qiagen, Hilden, Germany), and RNA purity was evaluated by calculating the A260/A280 ratio by nanodrop spectrophotometer, aiming for a value of 1.8–2.1. The primer pairs used for gene amplification from the cDNA template are listed in Additional file 2. The results from three independent reactions were used to determine the relative expression levels of the target genes, which were normalized to the expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a control. As for RNA sequencing, sample quality control of RNA integrity was performed using an Agilent 2100 Bioanalyzer—RNA 6000 Nano kit. High-quality RNA was selected based on samples with an RNA integrity number over 9.5. Qualified samples were then used to construct RNA-seq cDNA libraries following the standard Illumina protocol. cDNA libraries were quantified by qRT-PCR using a Roche LightCycler 480 system and Qubit Fluorometer (Invitrogen). The cDNA libraries were pooled and sequenced on an Illumina NextSeq 500 platform with single-end 76-bp reads.

Hu C.H., Tseng Y.W., Chiou C.Y., Lan K.C., Chou C.H., Tai C.S., Huang H.D., Hu C.W., Liao K.H., Chuang S.S., Yang J.Y, & Lee O.K. (2019). Bone marrow concentrate-induced mesenchymal stem cell conditioned medium facilitates wound healing and prevents hypertrophic scar formation in a rabbit ear model. Stem Cell Research & Therapy, 10, 275.

+ Open protocol

+ Expand

Dual-mode RNA Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA-seq and small RNA-seq cDNA libraries were constructed following the MGI mRNA library preparation assay (Hieff NGS^® Ultima Dual-mode RNA Library prep kit for MGI, 13333ES96) protocol, previously purified and fragmented with Hieff NGS^® mRNA Isolation Master Kit (Hieff NGS^®, Cat#12603). Resulting cDNA library fragments were validated using Agilent 2100 Bioanalyzer (Agilent) and cDNA libraries were measured using quantitative reverse-transcription PCR (qRT-PCR) (Roche, LightCycler^® 480 system, Basel, Switzerland) as well as Qubit fluorometer (Invitrogen, Carlsbad, California, USA). Then they were pooled, and sequenced on BGI NGS platform (DNBSEQTM-T7), pair-ended mode with 150 bps. Coverage depth were approximately 20 million and 5 million reads obtained in RNA-seq and miRNA-seq, respectively.

Tang Y., Chen Y.G., Huang H.Y., Li S.F., Zuo H.L., Chen J.H., Li L.P., Mao R.B., Lin Y.C, & Huang H.D. (2023). Panax notoginseng alleviates oxidative stress through miRNA regulations based on systems biology approach. Chinese Medicine, 18, 74.

+ Open protocol

+ Expand

Quantitative Real-Time RT-PCR Analysis of Inflammatory Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time RT-PCR was performed on a LightCycler®480 System using TaqMan® gene expression assays for TNF-α (Mm00443258_m1), IL-1β (Mm00434228_m1), IFN-γ (Mm01168134_m1), IL-6 (Mm00446190_m1), Gapdh (Mm999999_g1) and Actb (Mm00607939_s1) purchased from Life Technologies (Catalogue number 4331182). For the real-time RT-PCR setup the TaqMan Gene Expression Master Mix (Catalogue number 4369016, Life Technologies) was used. Reactions were carried out in triplicates according to manufacturer instructions using a 20 ng cDNA template for each reaction. As negative controls, amplifications without reverse transcription or template were included. Quantitative measurement of target gene levels relative to controls was performed with the 2^−ΔΔCt method (Schmittgen and Livak, 2008 (link)). Gapdh and Actb were used as endogenous housekeeping genes.

Farzi A., Reichmann F., Meinitzer A., Mayerhofer R., Jain P., Hassan A.M., Fröhlich E.E., Wagner K., Painsipp E., Rinner B, & Holzer P. (2015). Synergistic effects of NOD1 or NOD2 and TLR4 activation on mouse sickness behavior in relation to immune and brain activity markers. Brain, Behavior, and Immunity, 44, 106-120.

+ Open protocol

+ Expand

MAPT p.A152T Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotypes were obtained using TaqMan® SNP assays from Life Technologies on a LightCycler® 480 System. A custom assay (#AHHR7R6) was designed for MAPT p.A152T rs143624519. Forward primer sequence was CCAATGGTGAAAAACCCCTCTATCA and reverse primer sequence was TTGGCCTGGCCCTTCTG. Reporter sequences were AAAACGAAGATCACCACACC and ACGAAGATCGCCACACC. p.A152T carriers were confirmed using Sanger sequencing. Statistical analysis was performed in R (version 3.1.3, www.r-project.org).

Lopez A., Lee S.E., Wojta K., Ramos E.M., Klein E., Chen J., Boxer A.L., Gorno-Tempini M.L., Geschwind D.H., Schlotawa L., Ogryzko N.V., Bigio E.H., Rogalski E., Weintraub S., Mesulam M.M., Fleming A., Coppola G., Miller B.L, & Rubinsztein D.C. (2017). A152T tau allele causes neurodegeneration that can be ameliorated in a zebrafish model by autophagy induction. Brain, 140(4), 1128-1146.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Brain tissues were homogenized with the Precellys 24 homogenizer (Peqlab). RNA extraction was performed according to the manufacturer’s instructions using the RNeasy lipid tissue mini kit (Qiagen). The RNA concentration was measured and 2 µg of RNA was reverse-transcribed in the Mastercycler Gradient (Eppendorf, Hamburg, Germany), using the high capacity cDNA reverse transcription kit (Life Technologies) according to the manufacturer’s instructions. A control without reverse transcriptase for each group and area was always included. For relative quantification of mRNA levels, qPCR was performed on a LightCycler®480 System with TaqMan inventoried gene expression assays (listed in Supplementary Data) and the TaqMan gene expression master mix (Life Technologies). All samples were measured as triplicates. ACTB, GAPDH and PPIL3 were used as reference (endogenous housekeeping) genes for quantification of target gene expression. Quantitative measurements of target gene levels relative to controls were performed with the 2^-ΔΔCt method using the mean value of the vehicle-treated group as the calibrator (Livak and Schmittgen, 2001 (link)). Group differences were expressed as fold changes.

Fröhlich E.E., Farzi A., Mayerhofer R., Reichmann F., Jačan A., Wagner B., Zinser E., Bordag N., Magnes C., Fröhlich E., Kashofer K., Gorkiewicz G, & Holzer P. (2016). Cognitive Impairment by Antibiotic-Induced Gut Dysbiosis: Analysis of Gut Microbiota-Brain Communication. Brain, behavior, and immunity, 56, 140-155.

+ Open protocol

+ Expand

RNA Isolation, cDNA Synthesis, and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using TRIzol reagent (ThermoFisher Scientific, USA), and the concentration of RNA was measured by the absorbance at 260 and 280 nm. M-MLV Reverse Transcriptase (ThermoFisher Scientific, USA) was used for the reverse transcription of RNA into cDNA. Quantitative real-time PCR was performed using SYBR Green (ThermoFisher Scientific, USA) according to the instructions, and the assays were carried out in the LightCycler480 system.

Yang Y., Ma Y., Yan S., Wang P., Hu J., Chen S., Zhu J., Wang J., Chen G, & Liu Y. (2021). CAF promotes chemoresistance through NRP2 in gastric cancer. Gastric Cancer, 25(3), 503-514.

+ Open protocol

+ Expand

Analyzing Bnl gene expression via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted with TRIzol Reagent (Life Technologies, 15596018), purified with NZY total RNA isolation kit (NZYTech, MB13402) and treated with DNAseI. cDNAs were prepared from 0.8 μg of RNA using RevertAid H Minus First Strand cDNA Synthesis Kit and oligo-dT primers (Life Technologies, K1632). -RT controls were included in qPCR reactions to discard genomic DNA contamination. qPCR was performed on Roche LightCycler 480 System using SYBER Green Master Mix (ThermoFisher, K0221). Transcriptional levels were normalised to ribosomal protein RpL23.
Primers used:
Bnl F GGATGCAAGTACCACCACCA
Bnl R CCCTATCGCTGGTTTCGCTA
RpL23 F GACAACACCGGAGCCAAGAACC
RpL23 R GTTTGCGCTGCCGAATAACCAC

Letizia A., Espinàs M.L., Giannios P, & Llimargas M. (2023). The TNFR Wengen regulates the FGF pathway by an unconventional mechanism. Nature Communications, 14, 5874.

+ Open protocol

+ Expand

Quantitative PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR (qPCR) reactions were carried out with the Roche Light Cycler 480 system, using Power SYBR-Green PCR Master Mix (4367659, Thermo Fisher Scientific) according to the manufacturer’s instructions. Expression quantification data, obtained from the different samples and treatments, are expressed in terms of cycle threshold (Ct). The GAPDH gene was used as endogenous reference control. Ct values were averaged for each in-plate technical triplicate. The averaged Ct was normalized as difference in Ct values (ΔCt) between the analyzed gene and each reference gene in each sample in the analysis. The ΔCt values of each sample were then normalized to the ΔCt values of the control (ΔΔCt). The variation was reported as fold change (2^−ΔΔCt). qPCR primer sequences are shown in S3 Table.

Head S.A., Hernandez-Alias X., Yang J.S., Ciampi L., Beltran-Sastre V., Torres-Méndez A., Irimia M., Schaefer M.H, & Serrano L. (2021). Silencing of SRRM4 suppresses microexon inclusion and promotes tumor growth across cancers. PLoS Biology, 19(2), e3001138.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!