Hsa mir 16

An MiRNeasy Serum/Plasma Kit (Qiagen) and miRNeasy Mini Kit (Qiagen, Hilden, Alemania) were used to extract the total RNA from the serum samples and the cells, respectively. An MiRNA specific Taqman MicroAssay (#4427975; ID 002619; Applied Biosystems) and Taqman miRNA Reverse Transcription Kit (Applied Biosystems) were used for reverse transcription. Specific primers used for all the microRNAs were obtained from Applied Biosystems [hsa-miR-16 (internal reference): upstream primer sequence 5′TAGCAGCACGTAAATATTGGCG3′; hsa-miR-223-3p: upstream primer sequence 5′TGTCAGTTTGTCAAATACCCCA3′;hsa-miR-765:upstream primer sequence 5′TGGAGGAGAAGGAAGGTGATG3′;hsa-miR-33b-3p:upstream primer sequence 5′CAGTGCCTCGG CAGTGCAGCCC3′; The downstream primer comes with the Qiagen kit]. These reactions were all carried out in duplicate in the 96-well plates, and the data were evaluated with the help of 7900HT Fast Real-Time PCR systems (Applied Biosystems).

Spin column-based isolation of exosomal RNA from 1mL of urine was performed using exoRNeasy Serum/Plasma midi kits (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions. There was no DNA contamination and the integrity of the RNA was confirmed with agarose gel electrophoresis and Agilent 2100 Bioanalyzer. RNA was stored at -80°C until use. BKV microRNA expression was assessed by quantitative real-time reverse transcriptase PCR (qRT-PCR) using human TaqMan microRNA assays (Applied Biosystems, Foster City, CA). Reactions using 3 μL of RNA were performed with TaqMan microRNA Reverse Transcription Kit and TaqMan microRNA-specific primers (assay IDs: hsa-miR-16:000391, bkv-miRB1-5p:007796, bkv-miR-B1-3p:006801; Applied Biosystems). The qRT-PCR reaction contained 1 μL of reverse transcription product, 1x TaqMan Universal PCR mastermix, no AmpErase UNG, and 1 μL of primer mix. The complementary DNA (cDNA) was amplified using an ABI StepOnePlus real-time PCR system (Applied Biosystems). Reactions were incubated at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 60 s. A control sample was spiked with known concentrations of synthetic BKV microRNA mimic duplex oligonucleotides (bkv-miR-B1; IDT, Coralville, IA, USA). The sequences of the duplexes were 5’-AUCUGAGACUUGGGAAGAGCAU and 5’-UGCUUGAUCCAUGUCCAGAGUC [5 (link)].

Total RNA was extracted from frozen scraped colon mucosa according to the manufacturer's instructions for use of the TRIzol reagent (Invitrogen, Carlsbad, CA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer RNA 600 nano assay (Agilent Technologies, Santa Clara, CA). MicroRNA microarray profiling was conducted as previously described [32] (link). Five mg of total RNA was labeled and hybridized to the microRNA microarray (Ohio State microRNA microarray version 4.0, Columbus, OH). Microarray data was deposited into Gene Expression Omnibus (accession number GSE56025).
Quantitative RT-PCR was used to validate specific microRNAs. The microRNAs that were validated included: hsa-miR-16; mmu-let-7f; mmu-miR-351; has-miR-150; has-miR-425; hsa-miR-196a; hsa-miR-138; and mmu-miR-155 (Applied Biosystems, Foster City, CA). Taqman MicroRNA assays (Applied Biosystems) were used according to the manufacturer's instructions in a 7500 real-time RT-PCR system (Applied Biosystems). Mouse specific small nuclear (sn)/small nucleolar (sno), snoRNA 202, snoRNA 234, and snoRNA 142 endogenous controls were used as the normalization controls (Applied Biosystems). All assays were performed in triplicate.