Color reverse transcription kit with gdna remover

Total RNA was isolated from GH₃ cells by Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The cDNAs were obtained by Color Reverse Transcription Kit (with gDNA remover) (EZBioscience, Roseville, CA, USA). Genomic DNA (gDNA) was extracted using a Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China). Quantification of mRNA, miRNA, circRNA and gDNA was performed by using a SBRY Green PCR Kit (Takara, Tokyo, Japan), primers and Real-Time PCR System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) The circRNA and mRNA levels were normalized to those of β-actin, while the miR-709 levels were normalized to the U6 and determined by 2-DDCt method. The primer sequences for the amplification of specific primers are listed in supplementary Table S1. Sanger sequencing (chain termination sequencing) is a method of DNA sequencing based upon the selective incorporation of chain-terminating dideoxynucleotides (ddNTPs) during in vitro DNA replication [55 (link)].

Semi-quantitative RT-PCR was performed to verify the expression of OR genes. Antennae (500 individual) and legs (300 individual) were collected from monogyne individuals from five castes of the polygyne-type S. invicta, namely workers for foragers (WF), reserves (WR), and nurses (WN), alate virgin queen (AVQ), and males (M) [18 (link),72 (link)]. Total RNA was extracted as described in [73 (link)]. The cDNA was synthesized from total RNA using the Color Reverse Transcription Kit (with gDNA Remover) (EZBioscience, Roseville, California, USA). Gene-specific primers were designed using Primer Premier 5.0 software (Table S4) and synthesized by Tsingke Biotechnology Co., Ltd. (Guangzhou, China). Green Tap Mix (Vazyme Biotech Co., Ltd., Nanjing, China) was used for PCR under the following conditions: 95 °C for 5 min; 30 cycles of 95 °C for 15 s, 54 °C for 15 s, and 72 °C for 10 s; and extension at 72 °C for 5 min. The 20 μL reaction system consisted of 10 μL Green Tap Mix, 1 μL Primer F, 1 μL Primer R, 2 μL cDNA, and 6 μL ddH₂O. RT-PCR products were separated on 1% agarose gels, stained by ethidium bromide, and photographed under a UV light in a Gel Doc XR+ Gel Documentation System with Image Lab Software (version 6.1, Bio-Rad, Hercules, CA, USA).

After incubation with FK506 for 3 days, the supernatant was carefully aspirated and the cells were rinsed with PBS for three times. Then, the total cellular RNA was extracted with an EZ-press RNA Purification Kit (B0004DP, EZBioscience^®), and reversely transcribed into cDNA with Color Reverse Transcription Kit (with gDNA Remover) (A0010CGQ, EZBioscience^®) according to the manufacturer’s instructions. Real-time PCR amplification was performed using the Step One Plus Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, United States) by the following procedure: first at 95°C for 5 min, and then 40 cycles of 95°C for 15 s and 60°C for 60 s. The primer sequences of the neurotropic factors and glial markers are listed below. The relative quantification of gene expression was analyzed with the values of 2^–ΔΔCt, and normalized by GAPDH expression level. All detections were repeated three times separately.

RNA extraction from interested cells using EZ-press RNA Purification Kit (B0004D, EZBioscience). Ensure proper handling and storage of RNA to maintain its integrity. Convert the extracted RNA into complementary DNA (cDNA) using a reverse transcription reaction using Color Reverse Transcription Kit (with gDNA Remover) (A0010CGQ, EZBioscience). Prepare the PCR reaction mixture containing the cDNA template, gene-specific primers (GAPDH Forward: TTCTTTTGCGTCGCCAGCC, PTPRC Forward: GACACGGCTGACTTCCAGAT) and Color qPCR reagent kit (A0012-R1, EZBioscience). Perform the PCR amplification using qPCR ROCHE 480 instrument. The qRT-PCR data was analyzed by GraphPad Prism 8 using Student’s t test.