Immunostimulatory dna isd

The anti‐α‐tubulin antibody, aphidicolin, and nocodazole were purchased from Sigma‐Aldrich. The anti‐p‐ATM (Ser1981), cGAS, and GFP antibody were from Santa Cruz. Antibodies against ATM, Flag, mouse cGAS, human cGAS, STING, MRE11, PARP1, H2A, H2A.X, γ‐H2A.X p‐IRF3, and IRF3 were from Cell Signaling Technology; Alexa 488‐anti‐Sca‐1 was from Invitrogen and PECY7‐anti‐cKit; V450‐Ly6G and FITC‐anti‐GR1 were from BD Pharmingen; 2′,3′‐cGAMP and immunostimulatory DNA (ISD) were from InvivoGen; and ATP was from New England Biology, while GTP, Rad51, and Lamin B1 antibody were from Abcam.

The phosphatase inhibitor cocktail and protease inhibitor cocktail were purchased from Sigma-Aldrich (St. Louis, MO, USA). The following antibodies were used: Anti-cGAS (#15102), anti-TBK1 (#3504S), anti-phospho-TBK1 (#5483), anti-IRF3 (#4302), anti-phospho-IRF3 (#4947), anti-α-Smooth Muscle Actin (D4K9N) (#19245), anti-GAPDH (D16H11) (#5174), Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG (all from Cell Signaling Technology, Danvers, MA, USA). Anti-Collagen I (ab6308)) and anti-Collagen III (ab184993) were both purchased from Abcam (Cambridge, MA, USA). The ReverTra Ace qPCR RT Kit (FSQ-101) and SYBR RT-PCR kit (QPK-212) were purchased from Toyobo (Osaka, Japan). LPS was purchased from Sigma-Aldrich. Immunostimulatory DNA (ISD, TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA) was purchased from Invivogen (San Diego, CA, USA).