TRIzol Reagent (Invitrogen, USA) was used to extract total RNA following manufacturer’s instructions. MiR-1249 expression was measured by a Hairpin-itTM microRNA and U6 snRNA normalization RT-PCR quantitation kit (Genepharma, China). For VEGFA mRNA and HMGA2 mRNA, complementary DNA (cDNA) was synthesized using PrimeScriptTM reagent kit with gDNA Eraser (Takara, Dalian, China) and qRT-PCR was analyzed using SYBR Premix Ex Taq kit (Takara, Dalian, China). The relative expression of miRNA or mRNA was analyzed using 2-ΔΔCT method. All results were normalized to GAPDH or U6. The primers of VEGFA, HMGA2 mRNA, and GAPDH are listed in Supplementary table 1 .
Hairpin ittm microrna and u6 snrna normalization rt pcr quantitation kit
Manufactured by GenePharma
Sourced in China
The Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit is a product designed for the reverse transcription and real-time PCR quantitation of microRNA and U6 small nuclear RNA (snRNA) expression. The kit provides the necessary reagents and protocols for efficient and reliable microRNA and U6 snRNA detection and normalization.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Primescript reagent kit with gdna eraser, by Takara Bio (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Ab7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Taq pro universal sybr qpcr master mix, by Vazyme (1 mentions)
Fastpure cell tissue total rna isolation kit v2, by Vazyme (1 mentions)
Hiscript 3 all in one rt supermix perfect for qpcr, by Vazyme (1 mentions)
Cfx96 real time system 3, by Bio-Rad (1 mentions)
Custom gene qrt pcr quantitation kit, by GenePharma (1 mentions)
Transscript green one step qrt pcr kit, by Transgene (1 mentions)
Abi 7500 fast system, by Thermo Fisher Scientific (1 mentions)
6 protocols using hairpin ittm microrna and u6 snrna normalization rt pcr quantitation kit
1
Quantifying miRNA and mRNA Expression
2
Quantitative Analysis of RNA Molecules
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the exosomes, granulosa cells, or cultured KGN cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s protocol. The SuperScriptTM III Reverse Transcriptase (Invitrogen) and qPCR SYBR Green master mix (CloudSeq) were used for mRNA and circRNA qRT-PCR. The Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma) was used for miRNA qRT-PCR. qRT-PCR were performed on an Applied Biosystems AB7500 Real-Time PCR system. Each set of qRT-PCRs was repeated at least three times, and the fold change in the expression of each gene was analyzed using the ΔΔCt method [59 (link)]. U6 snRNA was used as an internal control for miRNAs, and the circRNA and mRNA levels were normalized to GAPDH. qRT-PCR primers of circRNAs, miRNAs and mRNAs are listed in Supplementary Table 1 .
3
miRNA Quantitation RT-qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FastPure® Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, China) was used to extracted RNA. Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, China) was used for miRNA. For RNA, HiScript®III All-in-one RT SuperMix Perfect for qPCR (Vazyme Biotech, China) was used for reverse transcription and Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech, China) was used for qPCR. Results were obtained using the CFX96TM Real-time System 3.1 software (Applied Bio-Rad). A minimum of 3 replicate wells were set up for each sample and further analyzed using the 2−ΔΔct method with U6 as the internal reference gene. All primers used in qPCR were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primer sequences were as follows: miR-588, forward GATGCTCTTTGGCCACAATG, and reverse TATGGTTGTTCTGCTCTCTGTCTC; U6, forward CGCTTCGGCAGCACATATAC, and reverse TTCACGAATTTGCGTGTCATC; CCL5, forward ATTTGCCTGTTTCTGCTTGCTCTTG, and reverse AACTGCTGCTGTGTGGTAGAATCTG; TGF-β, forward AAGGTGAGGAAACAAGCCCAGAG, and reverse AAGTGCTAGGATTACAGGCGTGAG; GAPDH, forward AGATCCCTCCAAAATCAAGTGG, and reverse GGCAGAGATGATGACCCTTTT.
4
Quantifying miRNA and mRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, USA) was used to extract total RNA in accordance with manufacturer’s instructions. MiR-150-5p expression was detected by a Hairpin-itTM microRNA and U6 snRNA normalization RT-PCR quantitation kit (Genepharma, China). For VEGFA mRNA, complementary DNA (cDNA) was synthesized using PrimeScriptTM reagent kit with gDNA Eraser (Takara, Dalian, China) and qRT-PCR was analyzed using SYBR Premix Ex Taq kit (Takara, Dalian, China). The relative expression of miRNA or mRNA was analyzed using the 2-ΔΔCT method. All results were normalized to GAPDH or U6 gene. The primers for VEGFA and GAPDH mRNA are listed below (Table 3 ):
5
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from kidney tissues and cells using Trizol, and RNA was quantified using OD 260 nm. cDNA reverse transcription and amplification were performed using the Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit, or Custom gene qRT-PCR Quantitation Kit (GenePharma, Suzhou, China). Relative gene expression was assessed using the 2–ΔΔCt formula, with U6 or GAPDH used as housekeeping genes. The primer sequences were as follows:
6
Quantitative Analysis of mRNA and miRNA-155
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Eastep TM total RNA extraction kit (Promage, Shanghai LS1030). We performed qRT-PCR analyses for mRNA using TransScript green one-step qRT-PCR kit (Transgen biotech, AQ211-01). GAPDH was used as an internal reference control. We performed qRT-PCR analyses for microRNA-155 using Hairpin-it TM microRNA and U6 snRNA normalization RT-PCR quantitation kit (GenePharma, E22002) in an ABI 7500 fast system (applied biosystems CA, USA). In short, 2mg total RNAs were reverse transcribed to cDNA, then qPCR was performed using specific primer set to examine expression of mRNAs and microRNA-155. The qRT-PCR results were calculated using the comparative threshold cycle (Ct) method. Specific primers used in the present study are as follows: has-microRNA-155, sense 5'-TAATGCTAATCGTGATAGGG-3', antisense 5'-TTTGGCACTAGCAC ATT-3'; U6 snRNA, sense 5'-CTCGCT TCGGCAGCACA-3', antisense 5'-AACGCTTCACGAATTTG CGT-3'; mTOR, sense 5'-AGGCCGCATTGTCTCTATCAA -3', antisense 5'-GCAGTAAATGCAGGTAGTCATCCA-3'; GAPDH: sense 5'-CCAGAACATCATCCCTGC-3', antisense 5'-GGAAGGCCATGCC AGTGAGC-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!