miRNA and mRNA expression levels were analyzed by qRT-PCR as described previously [50 (link)]. Briefly, by using the HiScript II Q Select RT SuperMix kit (Vazyme, Nanjing, China) to reverse transcribe RNA (1 μg) into cDNA. For miRNA, using a miRNA 1st-Strand cDNA Synthesis Kit (GeneCopoeia, Carlsbad, CA, USA) to synthesize cDNA. qRT-PCR were performed with AceQ qPCR SYBR Green Master Mix (Vazyme) in ABI ViiA 7 (Applied Biosystems, Carlsbad, CA, USA). Meanwhile, U6 and β-actin acted as the internal reference, respectively. The 2−ΔΔCt method was adopted to analyze the genes relative expression. Table S2 displayed the related primer sequences.
Mirna 1st strand cdna synthesis kit
Manufactured by GeneCopoeia
Sourced in United States
The MiRNA 1st-Strand cDNA Synthesis Kit is a complete system for the reverse transcription of miRNA to generate cDNA. It includes all the necessary components for efficient first-strand cDNA synthesis from miRNA.
Automatically generated - may contain errors
Lab products found in correlation
Abi viia 7, by Thermo Fisher Scientific (1 mentions)
Hiscript 2 q select rt supermix kit, by Vazyme (1 mentions)
Aceq qpcr sybr green master mix, by Vazyme (1 mentions)
Trizol reagent, by Yeasen (1 mentions)
1st strand cdna synthesis kit, by Yeasen (1 mentions)
Sybr green master mix, by Yeasen (1 mentions)
2 protocols using mirna 1st strand cdna synthesis kit
1
qRT-PCR Analysis of miRNA and mRNA
2
Quantitative Analysis of AKT1 and miR-520a-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from GC tissues or cells using the TRIzol reagent (Yeasen Biotechnology, Shanghai, China) based on the instructions provided by the manufacturer. The RNA was reversely transcribed into cDNA using the 1st strand cDNA Synthesis Kit (Yeasen Biotechnology). For the reverse transcription of miRNAs, the cDNA was synthesized using the miRNA 1st strand cDNA Synthesis Kit (GeneCopoeia, Wuhan, China). The qRT-PCR was performed using SYBR Green Master Mix (Yeasen Biotechnology). β-actin was used as internal reference. The primers for the target genes were as follows: AKT1 forward: AGCGACGTGGCTATTGTGAAG, reverse: GCCATCATTCTTGAGGAGGAAGT; β-actin forward: CATGTACGTTGCTATCCAGGC; reverse: CTCCTTAATGTCACGCACGAT; miR-520a-3p forward: GCCACCACCATCAGCCATAC; reverse: GCACATTACTCTACTCAGAAGGG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!