Briefly, DU145 cells were plated in 48-well flat-bottomed plates at 18,000 cells/well. On day one, cells were infected with lentiviral particles, at a multiplicity of infection = 10, delivering Rab27a or non-mammalian control shRNA (SHCLNV; Sigma-Aldrich) in the presence of hexadimethrine bromide (8 mg/ml, H9268; Sigma-Aldrich). Puromycin (1.25 mg/ml, P9620, Sigma-Aldrich) was added on day 2. Media were changed on day 5, and cells were cultured in the presence of Puromycin for a further six passages prior to experimental use. Rab27a expression was quantified by qRT-PCR (Applied Biosystems; Thermo Fisher Scientific), and expressed relative to the control cells. Exosome secretion was measured by nanoparticle tracking analysis (Nanosight, Malvern Instruments, Amesbury, UK) as described [15 ] and confirmed by immunofluorescence-based quantification of exosomes.
P9620
Manufactured by Merck Group
Sourced in Australia
The P9620 is a laboratory equipment product manufactured by Merck Group. It is a precision instrument designed for various scientific applications. The core function of the P9620 is to perform accurate measurements and analyses within a controlled laboratory environment. Detailed technical specifications and intended use cases are not available for this product.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Merck Group (4 mentions)
Penicillin, by Thermo Fisher Scientific (3 mentions)
Shclnv, by Merck Group (2 mentions)
Qrt pcr, by Thermo Fisher Scientific (1 mentions)
Nanoparticle tracking analysis, by Malvern Panalytical (1 mentions)
H9268, by Merck Group (1 mentions)
Cycloheximide (chx), by Merck Group (1 mentions)
E2375, by Merck Group (1 mentions)
A5862, by Merck Group (1 mentions)
Sml1091, by Merck Group (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Doxycycline, by Takara Bio (1 mentions)
G418 ro, by Merck Group (1 mentions)
Hexadimethrine bromide, by Merck Group (1 mentions)
Bgc 823, by GenePharma (1 mentions)
Sgc 7901, by GenePharma (1 mentions)
Sgc 7901, by National Collection of Authenticated Cell Cultures (1 mentions)
Mkn 45, by National Collection of Authenticated Cell Cultures (1 mentions)
Bgc823, by National Collection of Authenticated Cell Cultures (1 mentions)
8 protocols using p9620
1
Lentiviral Knockdown of Rab27a in DU145 Cells
2
Sourcing and Handling Chemical Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following compounds were obtained from Sigma: CHX (100 mg/mL stock in DMSO; C1988), PURO (10 mg/mL stock in water; P9620), ANS (10 mg/mL stock in DMSO; A5862), EME (100 mg/mL stock in water; E2375), and HHT (10 mg/mL stock in DMSO; SML1091). LTM (5 mM stock in DMSO; 506291) was obtained from Millipore. BVD (10 mM stock in DMSO) and DIDB (10 mM in DMSO) were kind gifts from Tin Tin Su (University of Colorado at Boulder) and Malia Potts (St. Jude Children's Research Hospital), respectively. NSC119893 (50 mM stock in DMSO) was obtained from the National Cancer Institute Development Therapeutics Program.
3
Mouse RAW 264.7 and iBMM Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse RAW 264.7 cells and iBMMs were cultured in RPMI‐1640 medium (catalog number 21870–076; Gibco/Thermo Fisher, VIC, Australia), supplemented with fetal calf serum (catalog number 12103; JRH Biosciences, VIC, Australia), 2 nm l ‐glutamine, 50 U mL−1 penicillin and 50 μg mL−1 streptomycin (catalog number 10378–106; Gibco/Thermo Fisher; complete medium). iBMMs stably expressing GFP‐LC31 were cultured in complete medium with puromycin dihydrochloride (5 μg mL−1; P9620; Sigma/Merck, VIC, Australia).
4
Doxycycline-inducible ISG20 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pools of stable cell lines allowing for doxycycline (dox)-inducible ISG20 expression were generated upon MLV-based retroviral gene transduction based on the pRetroX-Tight system of Clontech. Briefly, the corresponding MLV vectors were produced by transient DNA transfection of HEK293T cells with plasmids coding the structural MLV protein Gag-Prol-Pol, the pantropic Vesicular Stomatitis Virus G protein (VSVg), pRetroX-Tight-Puro and pRetroX-Tet-On vectors that code for a miniviral genome bearing expression cassettes for a resistance gene (Puromycin and Neomycin, respectively) and either ISG20, or the tetO transcriptional rtTA activator (ratios 8:4:4:4, respectively, for a total of 20 μg of transfected DNA for a 10-cm dish). Virion particles released in the supernatant of transfected cells were filtered, titered by exogenous RT activity [60 (link)] and used to challenge the indicated target cells. Pools of transduced cells were obtained upon selection with Puromycin and G418 (P9620 and G418-RO, Sigma). ISG20 expression was induced by incubation with doxycycline (631311, Clontech).
5
Lentiviral Knockdown of HuR in RAW 264.7 and BMMØs
6
CD163 Knockdown in Gastric Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5 gastric cancer cell lines MGC-803, BGC-823, SGC-7901, MKN1 and MKN45 were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China), and cultured in RPMI-1640 containing 10% fetal bovine serum (MKN45 with 20% FBS). To generate CD163 knocking-down BGC-823 and SGC-7901 cell lines, 1×104 cells were seeded into 12-wells plates, and infected with Lentivirus coated shRNA plasmids (5′- GGCTGTGGAGAGGCCATTAAT -3′) or control plasmids (5′-CAGTACTTTTGTGTAGTACAA -3′) according to the instruction (GenePharma, China). Puromycin was added 72 hours after infection at the concentration of 2 μg/mL (Sigma, P9620) until no dying cells were visible. For transfection assays, 2×105 cells were seeded into 6-wells and transfected with Higene (Applygen, C1506) following the manufacture's guidelines. Cells were washed with PBS and harvested with RIPA lysis buffer 48 hour after transfection.
7
Maintenance of AGS and MKN28 Gastric Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human stomach adenocarcinoma cell lines AGS and MKN28 were obtained from and authenticated by the Korean Cell Line Bank with STR profiling. The cells were maintained in RPMI 1640 (Gibco, Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific, Inc.), penicillin (100 U/ml, Thermo Fisher Scientific, Inc.) and puromycin (100 µg/ml, P9620; Sigma) and cultured at 37°C in a humidified air atmosphere containing 5% CO2.
8
Inducible Protein Expression in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs (CC-2517; Lonza, Houston, TX) and human lung fibroblasts (CC-2512; Lonza) were maintained at 37°C with 5% CO2 and grown under standard conditions. Rac1-GTPase inhibitor (NCS-23766; SelleckChem, Boston, MA) was at 100 μM, and Arp2/3 inhibitor (CK-666; Sigma-Aldrich, St. Louis, MO) was at 10 μM. Nocodazole (M1404; Sigma-Aldrich) and Taxol (T7402; Sigma-Aldrich) were used at indicated concentrations. Stable HUVEC populations were generated by inserting relevant transgenes into pLIX_402 (41394; Addgene, Cambridge, MA), a Gateway-compatible Tet-On lentivirus. P2 HUVECs were transfected with the pLIX virus, and puromycin at 2 μg/ml (P9620; Sigma-Aldrich) was added 4 d later. After 2 d, puromycin was added at 4 μg/ml. When HUVECs reached confluency, they were split 1:10 and frozen in liquid N2. Transgene expression was induced by overnight incubation with DOX (D9891; Sigma-Aldrich). For all experiments except the sprouting angiogenesis assay (described later), cells were assessed within 24 h of DOX treatment, and ECs with nuclear sizes <50% of median or ≥200% of median size were excluded from analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!