Epr21143

Sections of frozen metastatic melanoma tumor tissue were thawed at room temperature (RT) and fixed with pre-cooled Acetone and Ethanol for 10 minutes each. Sections were washed and incubated with blocking buffer (0.1% BSA in 0.1% TBS-T) for 1 hour at RT, prior to primary antibody incubation for 1 hour at RT with one of either 5µg/ml rabbit anti-IL-10 (polyclonal, Abcam), 8µg/ml rabbit anti-TNF-α (TNFA/1500R, Abcam), or 1µg/ml rabbit anti-TGFβ1 (EPR21143, Abcam) in addition to 10µg/ml rat anti-CD3 (CD3-12, Abcam) and mouse anti-CD20 (1/50 dilution, L26, Abcam). Sections were washed and incubated with 10µg/ml cross-adsorbed donkey secondary antibodies (Abcam): anti-rabbit IgG AF594, anti-mouse IgG AF488 and anti-rat IgG AF647. Sections were washed and mounted with ProLong Gold Antifade Mountant with DAPI (Thermo Fisher Scientific). Slides were incubated for 24 hours prior to visualization on the Olympus VS120-S6-W slide scanning microscope.

Single gene knockout clones were generated in lentiCRISPRv2 (one vector system). The vector backbone was purchased from Addgene (lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid # 52961; http://n2t.net/addgene:52961; RRID:Addgene_52961) ^{78 (link)}. The protocol for guide cloning and generation of the virus was as described in Sanjana et al.^{78 (link)}. The guide sequence for mouse TGFβ−1 KO is “CACCGTTGACGTCACTGGAGTTGTA” and non-targeting control (NTC) is “CACCAATATTTGGCTCGGCTGCGC”. The TGFβ−1 KO and control clones were selected using puromycin from Sigma (2ug/ml) in CT2A mouse glioma cell line. The TGFβ−1 KO was confirmed using western blotting (TGFβ−1 antibody from Abcam [EPR21143] (ab215715)).