qPCR amplification and analysis were performed using the StepOne Real-Time PCR Systems (Thermo Fisher, USA). All reactions (20-ng cDNA template and three replicates) were performed using PowerTrack SYBR green master mix (Thermo Fisher, USA, #A46109) using the StepOne Real-Time PCR Systems (Thermo Fisher, USA) according to the manufacturer's instructions. The PCR reaction conditions were as follows: preincubation at 95°C for 10 minutes; 40 cycles at 94°C for 10 seconds, 60°C for 30 seconds, and 72°C for 30 seconds and a final extension at 72°C for 3 minutes. Fluorescence was measured at the end of each annealing step. Amplification was followed by a melting curve analysis with continuous fluorescence data acquisition during the 56° to 80°C melt. The raw data were analyzed with the StepOne Real-Time PCR Systems (Thermo Fisher, USA), and the gene expression levels were normalized to mouse beta actin using the 2−ΔΔCt method. The following primers used: AG2G CD8-alpha F: CCTTACCAGTGACCGCCTTG; AG2G CD8-alpha R: CTGAGCAATGGTAGGTGCCA (Amplifies only AG2G DNA and RNA but not CD64 DNA or RNA). Mouse actin cDNA F: GGCTGTATTCCCCTCCATCG, Mouse actin cDNA R: CCAGTTGGTAACAATGCCATGT.
Stepone real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China, Germany, United Kingdom, Canada, Singapore, Switzerland, France, Italy, Belgium, Lithuania, Israel, Spain, Denmark
The StepOne Real-Time PCR System is a compact, flexible, and easy-to-use real-time PCR instrument designed for a wide range of applications. It provides reliable and accurate quantitative and qualitative analysis of DNA and RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (562 mentions)
Rneasy mini kit, by Qiagen (244 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (241 mentions)
Trizol, by Thermo Fisher Scientific (200 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (128 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (110 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (102 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (89 mentions)
Primescript rt reagent kit, by Takara Bio (77 mentions)
Sybr green master mix, by Thermo Fisher Scientific (74 mentions)
Taqman probe, by Thermo Fisher Scientific (70 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (70 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (62 mentions)
Sybr premix ex taq, by Takara Bio (60 mentions)
Rneasy kit, by Qiagen (57 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (54 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (53 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (53 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (51 mentions)
Thunderbird sybr qpcr mix, by Toyobo (46 mentions)
3 058 protocols using stepone real time pcr system
1
Quantitative PCR for AG2G CD8-alpha Expression
2
SARS-CoV-2 and HERV-K RNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from TA and plasma was extracted using QIAamp Viral RNA (Qiagen, Germany). Quantitative RT-PCR was performed using GoTaq Probe qPCR and RT-qPCR Systems (Promega, USA) in a StepOne Real-Time PCR System (Thermo Fisher Scientific, CA, USA). The primers, probes, and cycling conditions used to detect SARS-CoV-2 RNA have been described elsewhere [37 (link)], with a standard curve for the SARS-CoV-2 N gene (Microbiologics, MN, USA).
For HERV-K analysis, extraction and amplification were performed as described elsewhere [38 ]. Of note, the RNA concentration was determined (NanoDrop 2000, ThermoFisher Scientific, CA, USA) and adjusted to 10 μg before cDNA synthesis [0.5 μl of oligo (dT)20, 0.5 μl of random hexamer primers, 10 mM dNTPs, First-Strand Buffer, 0.1 M DTT, and 200 U SuperScript III First-Strand Synthesis System (Invitrogen, ThermoFisher Scientific, CA, USA)]. A total of 100 ng of cDNA (NanoDrop 2000, Thermo Fisher Scientific) was used to run 50-cycle real-time PCR [PowerUp SYBR Green Master Mix (Applied Biosystems, Thermo Fisher Scientific) in a StepOne Real-Time PCR System (Thermo Fisher Scientific, CA, USA)].
For HERV-K analysis, extraction and amplification were performed as described elsewhere [38 ]. Of note, the RNA concentration was determined (NanoDrop 2000, ThermoFisher Scientific, CA, USA) and adjusted to 10 μg before cDNA synthesis [0.5 μl of oligo (dT)20, 0.5 μl of random hexamer primers, 10 mM dNTPs, First-Strand Buffer, 0.1 M DTT, and 200 U SuperScript III First-Strand Synthesis System (Invitrogen, ThermoFisher Scientific, CA, USA)]. A total of 100 ng of cDNA (NanoDrop 2000, Thermo Fisher Scientific) was used to run 50-cycle real-time PCR [PowerUp SYBR Green Master Mix (Applied Biosystems, Thermo Fisher Scientific) in a StepOne Real-Time PCR System (Thermo Fisher Scientific, CA, USA)].
3
Optimizing Amplification of LGALS9 and HPRT Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The optimal amplification efficiencies of the LGALS9 gene and the endogenous HPRT gene were determined for the ALL primers that amplify all of the mRNA variants and for the FL and D5 mRNA variants. To this end, a concentration curve was performed from 20 to 0.02 ng·µL−1using the cDNA from the HaCaT cell line. A melting curve was performed to confirm that unspecific products were not obtained during the amplification. Each reaction was performed in a final volume of 10 µL, including 5 µL of 2X SYBR Green/Rox quantitative PCR (qPCR) Master Mix (Thermo Fisher Scientific, Inc.), 1 µL of forward primer (10 µm ), 1 µL of reverse primer (10 µm ) and 1 µL of cDNA (20 ng) from the HaCaT, SiHa and HeLa cell lines. The reactions were performed in the Step One Real‐Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Inc.).
The reactions were performed in triplicate in three different assays using the Step One Real‐Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Inc.). The programme conditions for the mRNA variants were as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s, 61 °C for 30 s and 70 °C for 30 s. For the ALL primers, the conditions were the same, but the Tm was 51 °C. The expression levels were determined using the2 Δ Δ C t
The reactions were performed in triplicate in three different assays using the Step One Real‐Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Inc.). The programme conditions for the mRNA variants were as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s, 61 °C for 30 s and 70 °C for 30 s. For the ALL primers, the conditions were the same, but the Tm was 51 °C. The expression levels were determined using the
4
Quantitative Analysis of GUS Expression in Transgenic Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of GUS mRNA in transgenic tobacco and Arabidopsis plants developed for the plasmids pKCaMV35SGUS and pSiM24GUS were evaluated by real-time quantitative RT-PCR [38] (link) using GUS-specific forward (5′-d-TTACGTCCTGTAGAAACCCCA-3′) and reverse (5′-d-ACTGCCTGGCACAGCAAT TGC-3′) primers. The qPCR assays were performed using the iTaq SYBR Green Supermix with ROX (Bio-Rad, USA) according to the manufacturer's instructions. Tobacco tubulin (by using forward 5′-d-ATGAGAGAGTGCATATCGAT-3′ and reverse 5′-d-TTCACTGAAGAAGGTGTTGAA-3′ primers) was used as an internal control to normalize the expression of GUS. The comparative threshold cycle (Ct) method (Applied Biosystems bulletin, part No. 4376784 Rev. C, 04/2007) was used to evaluate the relative expression levels of the transcripts. The threshold cycle was automatically determined for each reaction by the system set with default parameters (Step One Real-Time PCR System, Applied Biosystems). The specificity of the PCR was determined by melting curve analysis of the amplified products using the standard method installed in the system (Step One Real-Time PCR System, Applied Biosystems).
5
Comprehensive Chrysanthemum Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were extracted from chrysanthemum apical buds, leaves, stem, and roots using TRIzol reagent (Invitrogen) and treated with RNase-free DNase I (Promega). First-strand cDNAs were synthesized from 1 μg total RNA using an oligo d(T) primer and the SuperScript III RT-PCR system, according to the manufacturer’s instructions (Invitrogen). qRT-PCR reactions (20 μl volume containing 1 μl cDNA as the template) were run using the StepOne Real-Time PCR System (Applied Biosystems) in standard mode with the KAPA SYBR FAST Universal qRT-PCR Kit (Kapa Biosystems). The chrysanthemum UBIQUITIN gene (GenBank accession NM_112764) was used as an internal control.
Stem-loop reverse transcription54 (link) was performed to evaluate the expression of cmo-miR156. cDNAs were synthesized using a miR156 stem-loop primer and the SuperScript III RT-PCR system as described above. qRT-PCR reactions (20 μl volume containing 1 μl cDNA and the cmo-miR156F/stem-loop universal-R primer set) were run using the StepOne Real-Time PCR System (Applied Biosystems) as described above. The U6 gene was used as an internal control55 (link) for stem-loop qRT-PCR.
Each reaction was performed using three biological replicates and verified by melting curve analysis. All reactions were performed with at least three biological replicates. PCR primers are listed in Supplementary Table1 .
Stem-loop reverse transcription54 (link) was performed to evaluate the expression of cmo-miR156. cDNAs were synthesized using a miR156 stem-loop primer and the SuperScript III RT-PCR system as described above. qRT-PCR reactions (20 μl volume containing 1 μl cDNA and the cmo-miR156F/stem-loop universal-R primer set) were run using the StepOne Real-Time PCR System (Applied Biosystems) as described above. The U6 gene was used as an internal control55 (link) for stem-loop qRT-PCR.
Each reaction was performed using three biological replicates and verified by melting curve analysis. All reactions were performed with at least three biological replicates. PCR primers are listed in Supplementary Table
6
Bacterial RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using bacterial total RNA isolation kit (Tiangen, Beijing, China). cDNA synthesis was conducted using reverse transcription (Promega, Madison, WI, United States). Total cDNA (50 ng) was used for qRT-PCR using the Step One Real-Time PCR System (Applied Biosystems StepOne Real-Time PCR System, United States). The primers used for qRT-PCR are listed in Supplementary Table S1 . The level of 16S rRNA gene transcript was used to normalize the gene expression data, and the fold change of each gene was calculated as described previously (Pfaffl, 2001 (link)).
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated as described previously (Ren et al., 2004 (link)). The cDNA synthesis was conducted using reverse transcription (Promega, Madison, WI, USA). Total cDNA (50 ng) was used for qRT-PCR using the Step One Real-Time PCR System (Applied Biosystems StepOne Real-Time PCR System, USA). Primers used for qRT-PCR are listed in Supplementary Table S1 , and the level of 16S rRNA gene transcript was used to normalize the gene expression data, and fold change of each gene was calculated as described previously (Pfaffl, 2001 (link)).
8
Quantification of PHLPP1 and PHLPP2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured human or mouse islets or INS-1E cells using TriFast (PEQLAB Biotechnologie, Germany). cDNA synthesis (RevertAid reverse transcriptase, Thermo Fisher Scientific (TFS), MA, USA) and quantitative RT-PCR was performed as previously described (Ardestani et al., 2014 (link)). The Applied Biosystems StepOne Real-Time PCR system (Applied Biosystems, CA, USA) with TaqMan® Fast Universal PCR Master Mix for TaqMan assays (Applied Biosystems) were used for analysis. TaqMan® Gene Expression Assays were used for PHLPP1 (#Hs01597875_m1), PHLPP2 (#Hs00982295_m1), PPIA (#Hs99999904_m1), and TUBA1A (#Hs00362387_m1) for human, Phlpp1 (#Mm01295850_m1), Phlpp2 (#Mm01244267_m1), Ppia (#Mm03024003_g1), and Tuba1a (#Mm00846967_g1) for mouse, and Phlpp1 (#Rn00572211_m1), Phlpp2 (#Rn01431647_m1), Ppia (#Rn00690933_m1) and Tuba1a (#Rn01532518_g1) for rat. qPCR was performed and analyzed by the Applied Biosystems StepOne Real-Time PCR system. The ΔΔCT method was used to analyze the relative changes in gene expression.
9
Quantification of T-phyllo-GFP Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qRT-PCR reactions were performed in three biological replicates using total RNA samples extracted from three independent plants grown under identical conditions. The expression level of nat-T-phyllo-GFP mRNA in transgenic plants was evaluated by real-time quantitative RT-PCR. For qRT-PCR, gene-specific primers for native T-phylloplanin (#1 and #3) were used to evaluate T-phyllo-GFP transcript levels. The qRT-PCR assays were performed using iTaq SYBR Green Supermix with ROX (Bio-Rad, USA) according to the manufacturer's instructions. The tobacco tubulin gene (primers #4 and #5) was used as an internal control to normalize the expression of T-phyllo-GFP. The comparative Ct threshold cycle method (Applied Biosystems bulletin) was used to evaluate the relative expression levels of the transcripts. The threshold cycle was automatically determined for each reaction using default parameters (Step One Real-Time PCR System, Applied Biosystems). The PCR specificity was determined by melt curve analysis of the amplified products using the standard method installed in the System (Step One Real-Time PCR System, Applied Biosystems).
10
Quantification of PHLPP1 and PHLPP2 mRNA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!