Stratagene mx3000p system

Total RNA was extracted from tissues using TRIzol reagent (Invitrogen, US) according to the manufacturer’s instructions. mRNA was quantified and then reverse transcribed into cDNA using the 5 × All-In-One RT MasterMix cDNA Synthesis Kit (abm, Canada). EvaGreen 2 × qRT-PCR MasterMix-Low ROX (abm, Canada) was used to quantify fluorescence with specific primers for the mRNA. GAPDH was used as an internal control. All qRT-PCR experiments were performed using the Agilent Technologies Stratagene Mx3000P system (Agilent Technologies, Palo Alto, CA, USA). The data were processed with the 2^−ΔΔCt method, and the fold changes were normalized to the expression of the internal controls. The primer sequences are:
(GAPDH-F: CTCTCTGCTCCTGTTCGACAG,
GAPDH-R: GTGTAATCATATTGGAACATGTAG,
iNOS-F: ACTCAGCCAAGCCCTCACCTAC.
iNOS-R: TCCAATCTCTGCCTATCCGTCTCG.
IL-1β-F: TCGCAGCAGCACATCAACAAGAG.
IL-1β-R: AGGTCCACGGGAAAGACACAGG).

Total RNA was isolated and extracted from the adipose tissue after treatment by the use of RNAtrip reagent (Applygen Technologies, Beijing, China) and following the standard instructions. Reverse transcription was conducted using the All-In-One RT MasterMix kit (Abm, Richmond, BC, Canada) in accordance with the manufacturer’s protocols. Subsequently, mRNA expression was detected via quantitative real-time RT−qPCR on a Stratagene Mx3000P system (Agilent Technologies, La Jolla, CA, USA) using RealStar Fast SYBR qPCR Mix (Genstar, Beijing, China). An 18S RNA was regarded as the internal control to normalize the value. The target gene expression levels were normalized to the 18S RNA using the comparative Ct method (2^−ΔΔCt). The sequences of RT−qPCR primers are listed in Supplemental Table S1.

Quantitative RT-qPCR was used to determine the mRNA levels of the selected IRGs in the discovery cohort 1 of PPATs. Specifically, primers for the selected IRGs were used in combination with Brilliant III Ultra-Fast SYBR Green (ThermoFisher Scientific, Bedford, MA, USA) using the Stratagene Mx3000P system (Agilent Technologies, Madrid, Spain) following the manufacturer’s instructions. mRNA levels were determined to analyze the putative steady levels or the variability in the expression across the different groups of patients [i.e., with BPH or PCa and both under NW and OB conditions] using the MxPro 3.0 qPCR software (Agilent Technologies, Madrid, Spain).
Likewise, a microfluidic-based qPCR array (Standard BioTools, San Francisco, CA, USA) was used to simultaneously determine the gene expression levels of the 15 candidate IRGs in the second cohort of PPAT samples using a 48.48 Dynamic Array Plate (GE 48.48 Dynamic Array Reagent Kit with Control Line Fluid, Standard BioTools, San Francisco, CA, USA). Preamplification, exonuclease I treatment, and microfluidic-based qPCR array were implemented as previously described [41 (link),42 (link)] following the manufacturer’s instructions using the Biomark HD System and the Fluidigm Real-Time PCR Analysis v4.8.2 Software.

For RT-qPCR analysis, total RNA was extracted using TRIzol (Sigma-Aldrich, USA). cDNA synthesis was performed using a PrimeScript RT kit following the manufacturer’s instructions (Takara, Japan). RT-qPCR was performed using SYBR premix Ex Taq (Takara, Japan), and ROX fluorescence was then analyzed using a Stratagene Mx3000p system (Agilent Technologies, USA).

Total RNA was extracted from isolated platelets or blood plasma using a Liquid Total RNA Isolation Kit (RP4002, BioTeke, Beijing, China). The quantity and quality of RNAs were determined by Nanodrop 2000 spectrophotometer and analyzed by an agarose gel electrophoresis. In total, 2 μg of RNAs were used for cDNA synthesis using a PrimeScript™RT reagent Kit with gDNA Eraser (RR047A, TAKARA, Dalian, China). Q-PCR was performed using iQ™ SYBR^® Green Supermix (BIO-RAD, CA, USA) on a BIO-RAD CFX96 system. H-actin was used as the internal amplification control. The primers used for amplification lncRNA ROR and H-actin are listed in Table 1. The relative expression levels of lncRNA ROR were calculated by 2^−△CT method; while △CT = CT _{lncRNA ROR}–CT _U6. EBV DNA levels were determined using EB viral nucleic acid quantitative fluorescent probe PCR assay (Shengxiang Biotechnology, Hunan, China) on the Stratagene Mx3000P system (Agilent Technologies, CA, USA) at Department of Laboratory Medicine of Wuhan Union Hospital.Table 1

Primers used for cDNA synthesis and real time PCR

Primer	Sequence (5′ ~ 3′)
lncRNA ROR forward	CTCCAGCTATGCAGACCACTC
lncRNA ROR reverse	GTGACGCCTGACCTGTTGAC
H-ACTIN forward	AGCGAGCATCCCCCAAAGTT
H-ACTIN reverse	GGGCACGAAGGCTCATCATT