Prl sv40 renilla luciferase vector

Human DNA sequences (Coriell) with reference allele for rs72928038 (BACH2 intron) were cloned in forward orientation in the luciferase reporter vector pGL4.23 (Promega) using the primers: forward, AGCTAGGTACCACACTCAGTGGTTGGGGTTT, and reverse, TACCAGAGCTCCTGGATAGAGGTCCCAGTCG and the enzymes SacI and KpnI. Alternate allele plasmids were generated via site directed mutagenesis (Q5 SDM kit, New England Biolabs) using the following primers: forward, CGGATTTCCTaTAAGCTGATC, reverse, TCCCTATTTGTGTGTAATG.
Jurkat cells were maintained in culture at a concentration of 1x10⁰⁵/mL-1x10⁰⁶/mL. Approximately 0.5x10⁰⁶ cells per replicate (3 replicates) were co-transfected with 500 ng of firefly luciferase vector containing either the reference or alternate allele or an empty pGL4.23 vector as a control, and 50 ng pRL-SV40 Renilla luciferase vector (Promega), using the Lipofectamine LTX reagent. Cells were collected 48 hours post transfection and assayed using the Dual-Luciferase Reporter system (Promega). Firefly activity was normalized to the Renilla activity and expressed as fold change compared to the luciferase activity of the empty vector (RLU). A two-sided t-test was used to compare the luciferase activity between the two alleles.

HEK293 cells (2 × 10⁵ cells) were seeded in 24-well plates, and 24 h later, 0.2 μg of recombinant pGL3 basic vector containing various lengths of the promoter region of ARG2 sequence and 25 ng of pRL-SV40 renilla luciferase vector (Promega) were cotransfected into cells using 4 μg Lipofectamine. After 6 h of incubation, the medium was replaced with the regular medium. After 24 h of transfection, luciferase activity was detected with use of a luminometer (TD-20/20 Turner Designs, Promega) with luciferase assay reagent (Promega) as previously described (Zhang et al., 2008b (link)).

Cells were plated at 5.10⁴ cells/well in a 24-well plate. Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Antisense oligonucleotides were transfected as described in^{30 (link)}. For reporter assays, cells were treated with compound PA-1 before being transfected the following day with 100 ng/well of either pGL4-PM372 or pGL4-mut372 firefly luciferase reporter^{40 (link)}, mixed with 10 ng/well pRL-SV40 Renilla luciferase vector (Promega), used as a control for transfection efficiency. Firefly and Renilla luciferase activities were measured 48 h post-transfection using the Dual Luciferase Assay (Promega). Firefly luciferase activities were normalized for transfection efficiency by Renilla luciferase activity.

A pcDNA3.1 vector containing HIF-2α (EPAS1) (NCBI Reference Sequence: NM_001430.4) gene was kindly provided by Prof. David Russell from the Southwestern Medical Centre (Texas, USA). A region of 630 bp from −437 to +207 bp from the transcription start site of NANOG promoter was amplified with specific primers that contained XhoI and HINDIII restriction sites (NanogXho Forward 5′CTCGAGCGGCTGGTTTCAAACTCCTGA-3′ and NanogHINDIII Reverse 5′-TTCGAACCGGATGCTTCAAAGC-3′). The product was cloned into a TOPO vector (Invitrogen), and removed using XhoI/HINDIII restriction enzymes. The fragment was then cloned into the XhoI/HINDIII sites in a pGL3 Control vector (Promega). This construct was named pGL3-NANOG. Mutagenesis was performed using QuikChange site-directed mutagenesis (Stratagene) following the manufacturer’s procedure and using specific primers (Table S4 in File S1). Luciferase activity was measured using the dual luciferase reporter assay system (Promega) following the manufacturer’s instructions. Normalization was performed using PRL-SV40 Renilla luciferase vector (Promega).

The EGR3 wild-type (Wt) and mutant (Mt) 3′-UTR sequences were synthesized and sub-cloned into the psiCHECK luciferase reporter plasmid (Promega, Madison, WI, USA). 5-8F was seeded into a 12-well plate at a density of 5 × 10⁶ and each recombinant luciferase reporter plasmid and the miR-483-5p mimic were co-transfected using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions. The psiCHECK promoter vector was used as the control, and the pRL-SV40 Renilla luciferase vector (Promega) was used to normalize the activity of firefly luciferase. Twenty-four hours later, the luciferase activity in each well was detected using the Dual-Luciferase Reporter Assay System (Promega).

NCI-N87 and NCI-N87R cells were transfected with pTA-Luc and TCF/LEF luciferase reporter vectors (Promega, Madison, WI, USA). We co-transfected NCI-N87 and NCI-N87R cells with the TopFlash firefly luciferase reporter vector and pRL-SV40-Renilla luciferase vector (Promega). Additionally, we incubated the cells for 72 h to detect the Wnt signaling pathway activity. The dual-luciferase reporter method (Promega) was used to determine the relative luciferase activity.