Nucaway spin column

Northern blots were performed using a NorthernMax kit (Ambion) according to the manufacturer’s instructions. Briefly, 1.5 μg of total RNA for each strain of S. aureus were separated on a 1% MOPS (morpholinepropanesulfonic acid)-formaldehyde-agarose gel and transferred to a BrightStar-Plus positively charged nylon membrane (Invitrogen) using a Whatman Nytran SuPerCharge TurboBlotter kit (GE Healthcare Life Sciences) for 3.5 h. Samples were cross-linked to the membrane by baking at 80°C for 20 min. Biotin-labeled RNA probes were synthesized from DNA with gene-T7-specific primer sets (see Table S1 in the supplemental material) using a MaxiScript T7 transcription kit (Thermo Fisher), including the optional DNase digestion and cleanup with NucAway spin columns (Invitrogen). Probes were added to 10 ng/ml in Ultrahyb ultrasensitive hybridization buffer (Invitrogen), followed by incubation at 72°C for 16 h. The membranes were washed as directed using a NorthernMax kit, with the two high-stringency washes performed at 68°C. RNA was visualized with a chemiluminescent nucleic acid detection kit (Thermo Fisher) according to the manufacturer’s instructions.

Recombinant Cas9 protein containing a C-terminal 6X His was expressed and purified from E. coli as described previously in Karvelis, T. et al.^{72 (link)}. Single guide RNAs (guide RNAs) were generated by T7 in vitro transcription using AmpliScribe™ T7-Flash™ kit (Epicentre, USA) according to the manufacturer’s recommendations. Products were purified using NucAway™ Spin Columns (Invitrogen, Life Technologies Inc., USA) followed by ethanol precipitation.

The DNA fragment corresponding to the linear monomeric CEVd (Access No. M34917) [37 (link)] was constructed by applying a PCR-based method [38 (link)], cloned in pGEM-T Easy Vector (Promega, Madison, USA) and confirmed by sequencing (Kim et al., in preparation). CEVd was prepared by in vitro transcription after the plasmid vector was cut with EcoRI (Takara, Kusatsu, Japan) to provide a proper termination point. To prepare the Alexa-Fluor-594-labeled CEVd (red fluorescence), the CEVd-containing plasmid vector (1 μg) was transcribed in vitro with 100 units of T7 polymerase (New England Biolabs, Ipswich, USA) in the presence of 200 μM of ChromaTide^TM Alexa-Fluor-594-5-dUTP (Invitrogen, Waltham, USA) in a 30-µL reaction mixture at 37 °C for 3 h, following the manufacturer’s instructions. The reaction was stopped by treating the mixture with 2.5 units of RNase-free recombinant DNase I (Takara, Kusatsu, Japan) at 37 °C for 20 min. Finally, the Alexa-Fluor-594-labeled CEVd was purified with NucAway Spin Columns (Invitrogen, Waltham, USA).

Whole-mount in situ hybridization (WISH) in zebrafish embryos was performed as previously reported [22 (link)]. The DNA template for zebrafish pgap3 was amplified from the cDNA of WT embryos at 72 hpf with primers: Fw: CTGGACGTGTCGTGATGACT and Rev with T7: CAGTGAATTGTAATACGACTCACTATAGGGAGAGTAGATGGAGTAGAGAATG, amplicon length 361 bases. Fluorescein isothiocyanate (FITC)-labeled antisense probe was in vitro transcribed by a T7 RNA polymerase kit (Roche) and purified with NucAway spin columns (Invitrogen). Embryos for WISH were prepared by fixing with 4% paraformaldehyde in 1× PBS solution and treated with proteinase K. The antisense probe was hybridized with the fixed embryos at each developmental stage in hybridizing solution.

Total RNA was extracted using a RNeasy Mini Kit following the manufacturer’s instructions (Qiagen Sciences, Germantown, MD), and treated with Turbo-DNA-free DNase (Ambion). The DNase was removed using DNase removal reagents (Ambion). RNA samples were quantified using a NanoDrop spectrophotometer. RNA (15 μg) was mixed with loading buffer (formamide, bromophenol blue, xylene cyanol, EDTA), denatured at 90 °C for 2 min, loaded on a 1% bleach agarose gel, and run at 100 W for ~2 h. RNA was transferred onto nylon membrane in 20× SSC buffer at room temperature overnight followed by cross-linking two times at 254 nm. The membrane was incubated in DIG easy hybridization buffer at 42 °C for 1 h. Four antisense-oligo probes against hitPRS (Supplementary Table 2) were pooled together and labeled at 5’-ends with [γ-³²P]-ATP using T4 polynucleotide kinase. After labeling, G10 columns (NucAway spin columns, Invitrogen) were used to remove the unincorporated (γ-³²P) ATP. The labeled probes were added to the hybridization buffer and incubated at 42 °C overnight. One labeled probe against 16 S rRNA (Supplementary Table 2) served as a loading control. The membrane was washed 3× in wash buffer (0.5× SSC, 0.1%SDS) followed by exposure to a phosphorimager screen overnight, and the radioactive signals were detected using a phosphor image analyzer (Typhoon FLA 7000).

T7 in vitro transcription (NEB) was performed for eutR and mavR incorporating Bio-11-UTP (Fisher) where indicated. Transcripts were purified using NucAway Spin Columns (Invitrogen). Purified transcripts were incubated at the indicated concentrations in 1× structure buffer (Ambion RNase T1 kit), 2 ng/µl yeast RNA (Ambion) and brought to a total volume of 20 μl with RNase-free water. Samples were incubated at 85°C for 3 min followed by 20 min at 37°C. Following the addition of 5× RNA loading dye (50% glycerol, 0.1% bromophenol blue), samples were subjected to electrophoresis on 5% native TBE gels using 1× TBE as running buffer. Electrophoresed samples were transferred by capillary action to Zeta-probe membranes (BioRad) in 20× SSC. After UV crosslinking the RNA to the membrane, the membranes were subjected to the Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific). EMSAs were visualized using a Gel Doc XR + Gel Documentation System.