Premix ex taq sybr green pcr

Total RNA was extracted by using Total RNA Extraction Kit (Solarbo, Beijing, China), and reverse transcription was performed using the first-strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) following the manufacturers’ instructions. Real-time PCR was performed using Premix Ex Taq SYBR Green PCR (TaKaRa, Dalian, China) on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s guidelines. The primer sequences used are given in Supplementary Table S3.

Total RNA was extracted using Total RNA Extraction Kit (Solarbo, Beijing, China), and reverse transcription was performed using the first-strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturers' instructions. RT-PCR was conducted using Premix Ex Taq SYBR Green PCR (TaKaRa, Dalian, China) on an ABI PRISM 7300 plus (Applied Biosystems, Foster City, CA, USA) following the manufacturer's protocols. The primer sequences used in the study were as followed: PXN forward primer CAATGGCACAATCCTTGACC, PXN reverse primer GTGATGAGGACTGAGGCTG; GAPDH forward primer GGAGCGAGATCCCTCCAAAAT, and GAPDH reverse primer GGCTGTTGTCATACTTCTCATGG.

Briefly, total RNA was extracted with TRIzol and assessed by a spectrophotometer. Then, RNA from each group and 10 μl PCR reaction solution were added into 10 μl of the Prime Script RT Reagent Kit (Beyotime Biotechnology, Shanghai, China) for reverse transcription at conditions of 37°C (15 min) and 85°C (5 s). The primer was designed and synthesized by Shanghai Biotechnology Service Company in accordance with the gene sequence in the GenBank gene sequence design, together with OLIGO v6.6. Sequences are shown in Table 1. qPCR was performed using Premix Ex Taq SYBR Green PCR (TaKaRa) according to the manufacturer's instructions on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA). The mRNA level of individual genes was normalized to GAPDH and calculated by the 2^−ΔΔCT data analysis method.

Total RNA was extracted from FLS using TRIzol™ (Invitrogen), and reverse transcription was performed using first strand cDNA synthesis kit (TaKaRa, Dalian, China), according to the manufacturer’s instructions. Real-time PCR was performed using Premix Ex Taq SYBR Green PCR (TaKaRa), according to the manufacturer’s instructions, on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA). The sequences of the primers were as follows: GPI 5′-AGGCTGCTGCCACATA-AGGT-3′, 5′-AGCGTCGTGAGAGGTCACTTG-3′; gp78 5′-CCATCATCAG CGCCTAC CG-3′, 5′-AACCAGAGGCACCACATGAC-3′; Fas 5′-CCCACCTACGTA CTGGCCTA-3′, 5′ -CTTGGCCTTGGGTGTGTACT-3′; Bcl-2 5′-AGTTCGGTGG-GGTCATGTGTG-3′, 5′-CTTCAGAGACAGCCAGGAGAAATC-3′; Bax 5′-TTCTGACGGCAACTTCAACTG-3′, 5′-TGAGGAGGCTTGAGGAGTCTC- 3′; Survivin 5′- TGCCTGGCAGCCC TTTCTCA-3′, 5′-TGGCACGGCGCACTTTCTTC-3′; Caspase-3 5′-TGGAACAAATGG ACCTGTTGA-3′, 5′-TAATAACCAGGTGCTGTGGAGT-3′ and GAPDH 5′-TGACTT CAACAGCGACACCCA 3′, 5′ -CACCCTGTTGCTGTAG CCAAA −3′. GAPDH was used as the internal control.

The total RNA was extracted using TRIzol™ (Invitrogen), and reverse transcription was performed using a first‐strand cDNA Synthesis Kit (Takara) according to the manufacturer's instructions. Real‐time polymerase chain reaction (RT‐PCR) was performed using Premix Ex Taq SYBR Green PCR (Takara) on an ABI PRISM 7500 (Applied Biosystems) according to the manufacturer's instructions. The sequences of the primers were as follows: EIF4G1 forward, 5′‐TTGTGGATGATGGTGGCT‐3′, and reverse, 5′‐TTATCTGTGCTTTCTGTGGGT‐3′; GAPDH forward, 5′‐TGACTTCAACAG
CGACACCCA‐3′, and reverse, 5′‐CACCCTGTTGCTGTAGCCAAA‐3′. GAPDH served as the internal control. The 2^−ΔΔCt method was used for quantification and GAPDH was used as an endogenous control. The tissues with the value of 2^−ΔΔCt ≥ 3/2 were defined as up‐regulation, those with the value of 2^−ΔΔCt ≤ 2/3 were defined as downregulation, and those with the value between 3/2 and 2/3 were defined as stable.

Total RNA was isolated from cells using TRIzol^TM (Invitrogen). Samples with a ratio of absorbance at 260/280 nm >1.8 were used, and total RNA was reverse transcribed to complementary DNA (TaKaRa) according to the manufacturer’s instructions. Gene expression was analyzed by relative quantification using Premix Ex Taq SYBR Green PCR (TaKaRa) on an ABI 7500 Real Time PCR System (Applied Biosystems). The primer sequences were as follow: G6PI Forward: 5′-AGG CTG CTG CCA CAT AAG GT-3′ and reverse 5′-AGC GTC GTG AGA GGT CAC TTG-3′; HIF-1α Forward: 5′-CCT ATG ACC TGC TTG GTG CT-3′and reverse: 5′-GCA AGC ATC CTG TAC TGT CCT-3′; VEGF Forward: 5′-CAC CCA CCC ACA TAC ATA CA-3′ and reverse: 5′-CTC AAG TCC ACA GCA GTC AA-3′; bFGF Forward: 5′- GAT TCA GTG GGT TGG GGG CA-3′ and reverse: 5′-AGG TCA GGT GAG GTT CGG GG-3′; Angiopoietin-1(Ang1) Forward: 5′-GGC AGT ACA ATG ACA GTT TC-3′ and reverse: 5′-CTT TGT TGC TTT CAT AAT CGC-3′; Angiopoietin-2(Ang2) Forward: 5′-CAG AGG CTG CAA GTG CTG GAG AAC A-3′ and reverse: 5′-GAG GGA GTG TTC CAA GAG CTG AAG T-3′. Expression of GAPDH was tested as an endogenous control for relative quantification and the primer sequences were as follows: forward 5′-GTG TCC AGC CTG AAT TCC ACT-3′and reverse 5′-CAC CCT GTT GCT GTA GCC AAA-3′. Results were analyzed using the ΔΔCt method for relative quantification and depicted as mRNA expression fold change relative to GAPDH.