Control and FN-incubated CHX-treated fibroblasts were solubilized on ice in RIPA buffer (150 mM NaCl, 2 mM EDTA, 1% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, 10% glycerol, 50 mM HEPES, pH 7.5) containing Complete Inhibitory Cocktail (Merck). Homogenates were cleared of cellular debris by centrifugation at 20,000 g for 15 min at 4°C. Immunoprecipitates using anti-β1 integrin antibodies, isotype antibody control and Gammabind Plus Sepharose (Merck) were resolved on 8% gels. After electrotransfer to UltraCruz nitrocellulose membranes (Santa Cruz Biotechnology), the filters were blocked (5% non-fat dry milk in TBST: 150 mM NaCl, 50 mM Tris HCl, 0.1% Tween 20, pH 7.4) for 1 h. Membranes were than incubated with appropriate primary and HRP-conjugated secondary antibodies (Enzo Life Sciences). Immunoblots were visualized using Western Blotting Luminol Reagent (Santa Cruz).
Western blotting luminol reagent
Manufactured by Santa Cruz Biotechnology
Sourced in United States, Sweden, United Kingdom, France, Canada
The Western Blotting Luminol Reagent is a chemiluminescent substrate used for the detection of proteins in Western blotting. It is designed to produce a luminescent signal when exposed to the enzyme horseradish peroxidase (HRP), which is commonly used to label antibodies in Western blotting experiments.
Automatically generated - may contain errors
Lab products found in correlation
Bca protein assay kit, by Thermo Fisher Scientific (13 mentions)
Gapdh, by Santa Cruz Biotechnology (8 mentions)
Pvdf membrane, by Bio-Rad (8 mentions)
Nitrocellulose membrane, by Bio-Rad (7 mentions)
Ripa buffer, by Thermo Fisher Scientific (7 mentions)
Polyvinylidene fluoride membrane, by Merck Group (7 mentions)
Las 3000mini luminoimage analyzer, by Fujifilm (6 mentions)
Semi dry transfer system, by Bio-Rad (6 mentions)
Polyvinylidene difluoride membrane, by Merck Group (6 mentions)
Pvdf membrane, by Merck Group (6 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (5 mentions)
Bcl 2, by Cell Signaling Technology (4 mentions)
Protease inhibitor cocktail, by Roche (4 mentions)
Nupage novex 4 12 bis tris gel, by Thermo Fisher Scientific (4 mentions)
Chemidoc xrs system, by Bio-Rad (4 mentions)
Ripa lysis buffer, by Thermo Fisher Scientific (4 mentions)
Turbofect, by Thermo Fisher Scientific (4 mentions)
Halt protease inhibitor cocktail, by Thermo Fisher Scientific (4 mentions)
Nitrocellulose membrane, by Pall Corporation (4 mentions)
Nitrocellulose membrane, by Thermo Fisher Scientific (4 mentions)
181 protocols using western blotting luminol reagent
1
Immunoprecipitation and Western Blotting of β1 Integrin
2
Dystrophin and Cas9 Protein Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
iPSC-CMs or HEK293Ts were resuspended in lysis buffer (10% sodium dodecyl sulfate, 62.5 mM Tris [pH 6.8], 1 mM EDTA, and protease inhibitor). Mouse tissues were flash-frozen and crushed into a fine powder before being resuspended in lysis buffer. Protein concentration was determined by BCA assay, and 20–50 μg of total protein was loaded onto a 4%–20% acrylamide gel. Blots were then incubated with anti-dystrophin antibody (Sigma-Aldrich; D8168, 1:1000), anti-Cas9-N-terminal (Cell Signaling Technology; 7A9-3A3, 1:500), or anti-Cas9-C-terminal (Sigma Aldrich; 10C11-A12, 1:500) at 4°C overnight or with mouse anti-vinculin antibody (Sigma-Aldrich; V9131, 1:1,000) at room temperature for 1 h, followed by horseradish peroxidase antibody (Bio-Rad Laboratories) at room temperature for 1 h. Blots were developed using western blotting luminol reagent (Santa Cruz Biotechnology; sc-2048). Relative protein expression (densitometry) was measured using ImageJ’s Gel Analysis method, normalized to vinculin expression, and compared with the normalized WT dystrophin protein expression.
3
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested and suspended in RIPA lysis buffer (Thermo, Hercules, CA, USA) containing a mixture of protease inhibitor and phosphatase inhibitor (GenDEPOT, CA, USA) followed by centrifugation at 13,000 rpm for 30 min at 4 °C. Protein content of the supernatant was determined using a BCA kit (Thermo). Proteins (30 µg per well) were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) using a 10% PAGE gel with a Tris-glycine-SDS buffer and transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, MA, USA). These membranes were blocked with 5% skim milk (Sigma, St. Louis, MO, USA) at room temperature for 2 hrs followed by incubation with primary antibodies diluted with 3% BSA in Tris buffered saline containing 0.1% Tween 20 (TBS-T) overnight at 4 °C. Membranes were then washed with TBS-T and incubated with HRP-conjugated secondary antibody at room temperature for 2 hrs. Signals were detected using Western Blotting Luminol Reagent (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA).
4
Protein Expression Analysis in Skin Biopsies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein extracts from frozen patient skin biopsies were obtained from archived samples following the TRIzol isolation of RNA, as previously described [38 (link)]. Twenty micrograms of protein extracts per lane were separated on 11% SDS-PAGE. After electrophoresis proteins were blotted onto nitrocellulose membranes (Bio-Rad) with a semi-dry transfer cell (Bio-Rad). Myeloperoxidase (MPO) expression was evaluated after 24 h of incubation at 4°C with a monoclonal mouse anti-human MPO heavy chain (1:100; Santa Cruz Biotechnology, catalog number SC-16128). Load control was performed using monoclonal mouse anti-human GAPDH (1:200; Santa Cruz Biotechnology, catalog number SC-47724) after 1 h of incubation at room temperature. After washing, membranes were incubated with secondary goat anti-rabbit IgG (1:2000, HRP, Dako) for 45 min at RT. After washing, bands were visualized by the chemiluminescence detection system (Western blotting Luminol Reagent; Santa Cruz Biotechnology, Inc). For densitometry analysis, the Luminol images of the developed films were performed using Adobe Photoshop CC.
5
Western Blot Analysis of ERRα and Vimentin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were subjected to western blot analysis as previously reported [20 (link)]. Membranes were incubated overnight at 4 °C with anti-ERRα polyclonal antibody (Abcam: Cambridge, UK; dilution 1:1000) and anti-Vimentin (Santa Cruz Biotechnology, Inc.: Bergheimer Str. 89-2 69115 Heidelberg, Germany; dilution 1:1000). GAPDH antibody (Santa Cruz Biotechnology; dilution 1:2000) was used as an internal control. Membranes were incubated with horseradish peroxidase–conjugated secondary antibodies (Amersham Pharmacia Biotech: Piscataway, NJ, USA) for 1 h at room temperature. Proteins were visualized with the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) and exposed to Kodak X-Omat film (Santa Cruz Biotechnology). Where indicated, the bands intensity of western blot images was measured using the NIH ImageJ software (National Institutes of Health (NIH): Bethesda, MD, USA).
6
Western Blot for Cardiac and Skeletal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Western blot of iPSC-CMs, 2 × 106 cardiomyocytes were harvested and lysed with lysis buffer [10% SDS, 62.5 mM tris (pH 6.8), 1 mM EDTA, and protease inhibitor]. For Western blot of skeletal or heart muscles, tissues were crushed into fine powder using a liquid nitrogen-frozen crushing apparatus. Cell or tissue lysates were passed through a 25-gauge syringe and then a 27-gauge syringe, 10 times each one. Protein concentration was determined by BCA assay, and 50 μg of total protein was loaded onto a 4 to 20% acrylamide gel. Gels were run at 100 V for 15 min and switched to 200 V for 45 min, followed by a 1-hour 20-min transfer to a polyvinylidene difluoride (PVDF) membrane at 100 V at 4°C. The blot was incubated with mouse antidystrophin antibody (MANDYS8, Sigma-Aldrich, D8168), mouse anti-Cas9 antibody (Clone 7A9, Millipore, MAC133), or rabbit anti-GFP antibody (InvitroGen, A-11122) at 4°C overnight, and then with goat antimouse horseradish peroxidase (HRP) antibody or goat anti-rabbit HRP antibody (Bio-Rad Laboratories) at room temperature for 1 hour. The blot was developed using Western Blotting Luminol Reagent (Santa Cruz, sc-2048). The loading control was determined by blotting with mouse anti-vinculin antibody (Sigma-Aldrich, V9131).
7
Quantitative RT-PCR and Western Blot Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time RT-PCR was carried out using the SYBR Green kit (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. The relative expression levels of genes were normalized to the endogenous housekeeping gene β-actin. The primer sequence are list in Table 1 . For western-blot, the total cell protein was loaded for SDS-PAGE, and then transferred onto polyvinylidene difluoride membranes. Membranes were blocked with 5% non-fat dried milk for 2 h at room temperature, and then incubated with primary antibody (R & D Systems, Inc.) overnight at 4 °C. After washed with TBST for three times, membranes were incubated with secondary antibody for 2 h at room temperature. After washed with TBST, proteins were detected with western blotting luminol reagent (Santa Cruz Biotechnology, Santa Cruz, USA), β-actin were used as the internal standard.
primer sequence used in the study
| Gene name | Forward primer (5’–3’) | Reverse primer (5’–3’) |
|---|---|---|
| CD73 | GCCTGGGAGCTTACGATTTTG | TAGTGCCCTGGTACTGGTCG |
| EGFR | CCAAGGCACGAGTAACAA | ACATAACCAGCCACCTCC |
| VEGF | TTGCCTTGCTGCTCTACCTC | TGCATGGTGATGTTGGACTC |
| Akt1 | ACTGTCATCGAACGCACCTT | TTCTGCAGGACGCGGTTCTC |
| β-actin | TGACGTGGACATCCGCAAAG | CTGGAAGGTGGACAGCGAGG |
8
Protein Expression Analysis via Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were homogenized in 1X radioimmunoprecipitation assay buffer and western blotting was performed to analyze the protein expression. Briefly, protein concentrations were examined using a BCA protein assay (Invitrogen; Thermo Fisher Scientific, Inc.) and protein samples (40 µg) was separated by 15% SDS-PAGE. Proteins were transferred into nitrocellulose membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and the primary antibodies used in the immunoblotting assays were TGF-β1 (1:1,000, ab66043), ERK (1:2,000, ab54230), AKT (1:2,000, ab8805), cadherin (1:1,000, ab6528), fibronectin (1:1,000, ab2413), α-smooth muscle actin (α-SMA; 1:1,000, ab5831; all from Abcam, Shanghai, China) and β-actin (1:2,000, G8140; United States Biological, Salem, MA, USA) for 12 h at 4°C following blocking with 5% skimmed milk for 1 h at 37°C. Horseradish peroxidase-conjugated IgG (Bio-Rad Laboratories, Inc.) was used at a 1:5,000 dilution for 2 h at 37°C and detected using a Western Blotting Luminol reagent (sc-2048; Santa Cruz Biotechnology Inc., Dallas, TX, USA).
9
Oximacro-Hemagglutinin Interaction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate the interaction of Oximacro® with IAV Hemagglutinin (HA), aliquots of purified recombinant HA subtype H1N1 (A/Puerto Rico/8/1934) ectodomain (1–528 aa) (Sino Biological-11684V08H50) were incubated at 37°C for different times with Oximacro®. Then, mixtures were treated with SDS sample buffer, fractionated through 10% SDS–PAGE, and analyzed either by staining with Coomassie blue or immunoblotting using the rabbit anti-HA antibody (PA5-34929, ThemoScientific). Immunocomplexes were detected with a goat anti-rabbit Ig Ab conjugated to horseradish peroxidase (Life Technologies, Carlsbad, CA, United States) and visualized by enhanced chemiluminescence (Western Blotting Luminol Reagent, Santa Cruz).
10
Protein Extraction and Immunoblotting Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!