Escherichia coli str. TOP10, Pichia pastoris str. X33, and the pPICZα-A were purchased from Invitrogen Inc. The recombinant pPICZα-A/hIFN-link-ApoA-I plasmid was constructed earlier in our laboratory. E. coli str. TOP10 was used for the cloning and propagation of synthetic human GM-CSF in pPICZa-A and pPICZα-A/hIFN-link-ApoA-I plasmids. Pichia pastoris str. X33 was used for cloning pPICZa-A/hGM-CSF and pPICZa-A/hGM-CSF-link-ApoA-I plasmids and expression and production of the authentic and chimeric forms of recombinant human GM-CSF.
Ppiczαa
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Germany
The PPICZαA is a plasmid vector used for the expression of recombinant proteins in Pichia pastoris yeast cells. It contains a strong methanol-inducible promoter, a secretion signal, and a C-terminal c-myc epitope tag and a His6 tag for detection and purification purposes.
Automatically generated - may contain errors
Lab products found in correlation
P pastoris x 33, by Thermo Fisher Scientific (6 mentions)
P pastoris strain x 33, by Thermo Fisher Scientific (6 mentions)
Pichia pastoris x 33, by Thermo Fisher Scientific (5 mentions)
Zeocin, by Thermo Fisher Scientific (5 mentions)
Xbai, by Takara Bio (4 mentions)
Ppic3.5k, by Thermo Fisher Scientific (4 mentions)
Gluconic acid, by Merck Group (4 mentions)
Avicel ph 101, by Merck Group (4 mentions)
Pichia pastoris gs115, by Thermo Fisher Scientific (3 mentions)
Gs115, by Thermo Fisher Scientific (3 mentions)
Sorbitol, by Merck Group (3 mentions)
T4 dna ligase, by Takara Bio (3 mentions)
Ecori, by Thermo Fisher Scientific (3 mentions)
P pastoris km71h, by Thermo Fisher Scientific (2 mentions)
Ascorbate, by Merck Group (2 mentions)
Escherichia coli trans1 t1, by Transgene (2 mentions)
Escherichia coli dh5α, by Thermo Fisher Scientific (2 mentions)
Restriction enzyme, by New England Biolabs (2 mentions)
Escherichia coli top10, by Thermo Fisher Scientific (2 mentions)
Ppic9k, by Thermo Fisher Scientific (2 mentions)
87 protocols using ppiczαa
1
Production of Recombinant Human GM-CSF
2
Optimized α-L-rhamnosidase Gene Expression in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding α-L-rhamnosidase (NCBI accession number JN899401.1) from A. terreus (Rha) was optimized based on the preferred codon usage of P. pastoris and synthesized by Shanghai Generay Biotech Co. Ltd. (Shanghai, China). The synthetic gene (MRha) was inserted into plasmid pPICZαA (Invitrogen, USA) to generate the expression vector pPICZαA/MRha, which were linearized with SacI and transformed into yeast strain P. pastoris KM71H (Invitrogen, USA) by electroporation. The sequence alignment of Rha and MRha was shown in Additional file 1 : Figure S1.
3
Recombinant Expression of FcγRIIIa
4
Cloning and Expression of Rat r-sFNDC5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rat r-sFNDC5 cDNA (167 amino acids) was designed and synthesized and then cloned into the EcoRI/XbaI site of pPICZαA (Invitrogen, USA). The resulting pPICZαA-sFNDC5 plasmid was transformed into Pichia pastoris X-33 competent cells following the manufacturer’s instructions (Pichia Easycomp Transformation Kit, Invitrogen, USA).
5
Recombinant Xyn11-29 Production in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Xyn11-29 was produced using the 3PE Platform (P. pastoris Protein Express: www.platform3pe.com/ , accessed on 5 May 2021). The cDNA encoding Xyn11-29 was synthesized after codon optimization for P. pastoris (GeneArt, Regensburg, Germany) and inserted into the vector pPICZαA (Invitrogen) using XhoI and XbaI restriction sites in frame with the α-factor and the (His)6 tag at the C terminus of the recombinant protein.
The PmeI-linearized pPICZαA recombinant plasmid was inserted into P. pastoris-competent cells by electroporation. Zeocin-resistant transformants were then screened for protein production. P. pastoris strain X33 and the pPICZαA vector are components of the P. pastoris Easy Select Expression System (Invitrogen). Electrocompetent cell preparation, electroporation, and screening were carried out as previously described [18 (link)]. Protein production was confirmed by SDS-PAGE.
The PmeI-linearized pPICZαA recombinant plasmid was inserted into P. pastoris-competent cells by electroporation. Zeocin-resistant transformants were then screened for protein production. P. pastoris strain X33 and the pPICZαA vector are components of the P. pastoris Easy Select Expression System (Invitrogen). Electrocompetent cell preparation, electroporation, and screening were carried out as previously described [18 (link)]. Protein production was confirmed by SDS-PAGE.
6
Recombinant Production of Collagen and Fibronectin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding RHC was cloned into the plasmids containing pET-3c (Invitrogen, United States) expression vector, and the recombinant plasmid named pET3c-hlcollagen was constructed and transformed into Escherichia coli BL21 (DE3) (Invitrogen, United States). After that, the best expression conditions was selected by screening for ampicillin resistance and induction by isopropyl β-d -1-thiogalactopyranoside (Invitrogen, United States). A 50 L fermentor was used for generating large-scale production of RHC. In addition, RHC was purified by using affinity chromatography on a Ni Sepharose six Fast Flow (Sigma, Germany) column combined with gel filtration Sephadex G-25 (Sigma, Germany).
The gene encoding rhFN was cloned into the pPICZαA (Invitrogen, United States) expression vector to generate a recombinant plasmid named pPICZαA-rhFN. After linearizing the recombinant plasmid with sall enzyme (Takara, Japan), it was transferred into GS115 Pichia pastoris competent cells (Invitrogen, United States) and screened for positive transformants. Afterwords, recombinant human-like fibronectin was expressed by biological fermentation. Moreover, the nucleotide sequence was adapted by the host cell codon to optimize the expression of recombinant fibronectin.
The gene encoding rhFN was cloned into the pPICZαA (Invitrogen, United States) expression vector to generate a recombinant plasmid named pPICZαA-rhFN. After linearizing the recombinant plasmid with sall enzyme (Takara, Japan), it was transferred into GS115 Pichia pastoris competent cells (Invitrogen, United States) and screened for positive transformants. Afterwords, recombinant human-like fibronectin was expressed by biological fermentation. Moreover, the nucleotide sequence was adapted by the host cell codon to optimize the expression of recombinant fibronectin.
7
Inducible Expression of Botulinum Toxin B Hc in Pichia pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the inducible expression of BHc in P. pastoris (Table 4 ), four recombinant plasmids were constructed by cloning the BHc or mBHc genes into pPICZαA (Invitrogen, Carlsbad, CA, USA) or pPICZαA-pre (a pre-peptide instead of the pre-pro-peptide) at Xho I (5′) and Not I (3′), respectively. Briefly, the BHc gene was amplified by PCR from pGEM-BHc (containing a completely synthetic gene encoding the Hc domain of BoNT/B, amino acids 853–1291, ~50 kDa)24 (link) and cloned into pPICZαA or pPICZαA-pre to produce recombinant pPICZαA-BHc and pPICZαA-pre-BHc, respectively. To eliminate the potential N-linked glycosylation site of BHc, a mBHc gene encoding a BHc mutant, in which N957 of BHc was mutated to Q957, was cloned by mutagenesis. The mBHc gene was cloned into pPICZαA or pPICZαA-pre to construct pPICZαA-mBHc and pPICZαA-pre-mBHc, respectively. The pPICZαA is an expression vector, in which the expression of BHc is under the control of the P. pastoris Alcohol oxidase 1 (AOX1) promoter. The α-factor pre-pro-peptide containing a KEX2 cleavage site was used to direct the secretion of BHc. The α-factor pre-peptide could also direct the secretion of BHc21 (link).
8
Recombinant Expression of BxCDP1 in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORF for BxCDP1 was amplified from B. xylophilus cDNA using primers with vector‐specific extensions (Table S1 ). The purified PCR product was inserted into the linearized vector pPICZαA (Invitrogen), which contains a 6 × His tag. The construct was transformed into Escherichia coli TOP10 competent cells. Individual colonies from the construct were tested by PCR for insertions, and the selected clones were verified by sequencing. The constructed plasmid was linearized with SacI (New England Biolabs). The pPICZαA vector containing BxCDP1‐6 × His and EV were transformed into the P. pastoris KM71H (Invitrogen) via electroporation. Positive clones were grown in yeast extract‐peptone‐dextrose (YPD) medium containing 100 µg/ml zeocin at 30 °C for 3 days. BMGY (buffered glycerol‐complex medium) and BMMY (buffered methanol‐complex medium) were used for protein expression. After 4 days, the cultures were centrifuged at 6,500 rpm for 10 min to procure the supernatant containing BxCDP1‐6 × His and EV, respectively, as confirmed by SDS‐PAGE. Purification of the recombinant protein BxCDP1‐6 × His and EV from the culture supernatant was performed by affinity chromatography using Ni‐NTA Superflow resin (Qiagen).
9
DyP1 Recombinant Protein Production in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DyP1 was produced using the in-house 3PE Platform (P. pastoris Protein Express: www.platform3pe.com/ , accessed on 19 April 2021). The cDNA encoding DyP was synthesized after codon optimization for P. pastoris (GeneArt, Regensburg, Germany) and inserted into the vector pPICZαA (Invitrogen, Cergy-Pontoise, France) using XhoI and XbaI restriction sites in frame adding a C-terminal (His)6-tag to the recombinant protein.
P. pastoris strain X33 and the pPICZαA vector are components of the P. pastoris Easy Select Expression System (Invitrogen). The PmeI-linearized pPICZαA recombinant plasmid was inserted into P. pastoris competent cells by electroporation. Zeocin-resistant transformants were then screened for protein production.
P. pastoris strain X33 and the pPICZαA vector are components of the P. pastoris Easy Select Expression System (Invitrogen). The PmeI-linearized pPICZαA recombinant plasmid was inserted into P. pastoris competent cells by electroporation. Zeocin-resistant transformants were then screened for protein production.
10
Construction of Yeast Expression Vector for CEA-Specific scFv
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mammalian expression vector pCEP4-MFE-23-NC1ES-encoding the CEA-specific MFE-23 scFv-based N-terminal trimerbody, containing a murine TIEXVIII domain, has been previously reported [16 (link)]. To generate the P. pastoris expression vector the DNA fragment encoding the MFE-23 scFv was PCR amplified from pCEP4-MFE-23-NC1ES- with primers EcoRI FW and NotI RV (Table 1 ). The EcoRI /NotI-digested PCR fragment was ligated into the EcoRI/NotI-digested backbone of plasmid pPICZαA (Life Technologies) to generate the intermediate plasmid pPICZαA-MFE-23. The DNA encoding human TIEXVIII was PCR amplified from plasmid pCR3.1-L36-hNC1 [18 (link)] with primers NotI FW and SalI RV (Table 1 ). The NotI/SalI-digested PCR fragment was ligated into the NotI/SalI-digested backbone of plasmid pPICZαA-MFE-23 to obtain pPICZαA-MFE-23-TIE. The sequence was verified using primers 5’ AOX1 and 3’AOX1 (Table 1 ).
| EcoRI FW | ATTTCACAGAATTC CAGGTGCAGCTGCAGCAGTCT | This study |
| NotI RV | ATTTCACAGCGGCCGC CCGTTTCAGCTCCAGCTT | This study |
| NotI FW | ATTTCACAGCGGCCGC GAATTCAGGCGCC | This study |
| SalI RV | ATTTCACAGTCGAC TTATTAATGGTGATGATGGTG | This study |
| 5′ AOX1 | GACTGGTTCCAATTGACAAGC | Life Technologies |
| 3′ AOX1 | GCAAATGGCATTCTGACATCC | Life Technologies |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!