Total RNA was isolated by the RNeasy Micro Kit (Qiagen Venlo, Netherlands) and reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad). Real-time PCRs were carried out with the “StepOne Real-Time RT-PCR System” (Applied Biosystems) and performed with TaqMan assays (Supplementary Table 2). The gene expression (fold change) was analyzed by the 2−ΔΔCt formula.
Stepone real time rt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOne Real-Time RT-PCR System is a compact, user-friendly instrument designed for real-time PCR applications. It features a 96-well format and supports a wide range of fluorescent dyes and probes for accurate gene expression analysis and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Taqman rt pcr technology, by Thermo Fisher Scientific (1 mentions)
Hs00426835 g1, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
5 protocols using stepone real time rt pcr system
1
Quantitative Transcriptome Analysis
2
RT-qPCR Analysis of mTOR Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy Micro kit (Qiagen, Venlo, Netherlands) and reverse transcripted into total cDNA with the iScript cDNA Synthesis Kit (Bio-Rad). Real time RT-PCR reactions were carried out with the “StepOne Real-Time RT-PCR System” (Applied Biosystems, Waltham, MA, USA), performed with specific primers for mTOR, RAPTOR and RICTOR using Taqman® RT-PCR technology (Applied Biosystems). The gene expression (fold change) was measured with the comparative threshold cycle (Ct) method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as endogenous control and the 2-ΔΔCt formula [56 (link)].
3
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Catalog Number 15596018, Invitrogen, Carlsbad, CA, USA) was used to isolate RNA according to manufacturer’s instructions. Total RNA was quantified with a Nanodrop Spectrophotometer (NanoDrop 2000, Nanodrop Technologies LLC, Thermo Fisher Scientific, Wilmington, DE, USA). Isolated RNA was stored at −80 °C until processing. RNA was reverse-transcribed by using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer’s recommendations. Quantitative real-time PCR was performed on the resulting cDNA using SYBR green PCR Master Mix (Applied Biosystems) on a StepOne Real-time (RT)-PCR System (Applied Biosystems). Primers for ACTA2 were obtained from Applied Biosystems (Hs00426835_g1). The sequences for COL1A1 primers were: Forward GGGCAAGACAGTGATTGAAT, Reverse GGAGTTTACAGGAAGCA-GACA; TGFB1 were: Forward GAGCCCTGGACACCAACTAT, Reverse GCAGAAGTTGGCATGGTAGC. Primer specificity was verified by observing a single peak on the melting curve. The fold change in expression of the target genes was calculated by the ΔΔCt method relative to β-actin (ACTB) (Forward TAGTTGCGTTACACCCTTTC; Reverse GCACGAAGGCTCATCATT) as the endogenous control.
4
Real-Time RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy Mini kit (Qiagen Venlo, Netherlands) and reverse transcribed into total cDNA with the iScript cDNA Synthesis Kit (Bio-Rad Hercules, California, U.S.). Real-time RT PCR reactions were carried out using the “StepOne Real-Time RT-PCR System” (Applied Biosystems) and Taqman® Real Time PCR technology (Applied Biosystems) [34 (link)]. The relative gene expression (fold change) was measured with the comparative threshold cycle (Ct) method using GAPDH as endogenous control and the 2−ΔΔCt formula [35 (link)].
5
Quantitative RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Invitrogen, New York, NY, USA) and transcribed into cDNA with a RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Scientific, MA, USA). RT‒qPCR was performed using the Applied Biosystems StepOne™ Real-Time RT‒PCR System with PowerUp™ SYBR® Green Master Mix (Applied Biosystems, Foster city, USA). Primers are listed in Supplementary Table 1 . β-Actin was used as the internal control to correct for variation in cDNA content among samples. No nonspecific amplification product was observed for any of the reactions, as determined from an analysis of the dissociation curves. Data were normalized to the β-actin expression levels. Relative mRNA abundance of the target genes was calculated by the 2-ΔΔCt method, where Ct represents the threshold cycle.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!