Methyldetector kit

Manufactured by Active Motif

Sourced in United States

The MethylDetector kit is a laboratory product designed to detect and analyze DNA methylation patterns. It provides a straightforward and efficient method for assessing the methylation status of DNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Dneasy blood and tissue kit, by Qiagen (4 mentions) Genelute mammalian genomic dna miniprep kit, by Merck Group (4 mentions) Methyl primer express software v1, by Thermo Fisher Scientific (2 mentions) Epityper massarray, by Agena (2 mentions) Pcr4 topo ta vector, by Thermo Fisher Scientific (2 mentions) 5 mc dna elisa kit, by Zymo Research (1 mentions) Dneasy blood tissue kit, by Qiagen (1 mentions) Topo cloning vector, by Thermo Fisher Scientific (1 mentions) Dneasy kit, by Qiagen (1 mentions) Epidesigner software, by Agena (1 mentions) Topo ta cloning vector, by Thermo Fisher Scientific (1 mentions) Facsaria 2 cell sorter, by BD (1 mentions) Pcr2.1 topo vector, by Thermo Fisher Scientific (1 mentions) Dna isolation kit, by Qiagen (1 mentions) Miseq deep sequencing, by Illumina (1 mentions)

18 protocols using methyldetector kit

Methylation Analysis of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted using the DNeasy blood & tissue kit (Qiagen). For the bisulfite conversions assay, genomic DNA was subjected to bisulfite treatment using MethylDetector kit (Active Motif). The PCR products were separated in agarose gels, purified, then sub cloned into the T vector. After screening for positive clones by digestion of plasmids with EcoRI, more than 10 clones for each sample were sequenced to identify the methylation status of cytosine. The methylation level was presented as CG methylation ratio (fraction of methylated CpG over total CpG sites). The global DNA methylation status was determined as described [67] using an ELISA assay (5-mC DNA ELISA kit, Zymo Research, Irvine, CA, USA) or liquid chromatography (LC)-Mass spectrometry. The Elisa kit is based on the recognition and quantification of the methylated DNA fraction using a 5-methylcytosine antibody. Percent 5-mC in a DNA sample is quantified from a standard curve generated by methylated/demethylated E. coli DNA. WT and KO MEFs (derived from Lsh+/+ and Lsh-/- embryos) served as control samples. Primers are listed in supplement Table S1.

Ren J., Finney R., Ni K., Cam M, & Muegge K. (2019). The chromatin remodeling protein Lsh alters nucleosome occupancy at putative enhancers and modulates binding of lineage specific transcription factors. Epigenetics, 14(3), 277-293.

+ Open protocol

+ Expand

Bisulfite Sequencing Protocol for LY75 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

BSP analysis was performed, as previously described. Briefly, genomic DNAs from EOC tumors and control ovarian tissues were isolated using the Qiagen DNeasy Blood and Tissue Kit. Bisulfite modification of genomic DNAs was done using the Methyl Detector kit (Active Motif, Carlsbad, CA). For BSP, a 348-bp fragment was amplified using primer pairs specific for bisulfite-modified sequences but not harboring CpGs, located at nt + 304 (GATTTTGAGAGGGAGGGT) to nt + 619 (ATCAAAAAAATAAACCCAACTCT) downstream of the LY75 transcription start (ATG) codon. BSP primer selection was performed using the Methyl Primer Express Software v1.0 (Applied Biosystems). PCR was done for 30 cycles (94°C, 45 s; 60°C, 45 s; 72°C, 45 s). PCR products were sent for dideoxy-sequencing analysis at the Genomics Analysis Platform at Laval University (http://www.bioinfo.ulaval.ca/seq/en/).

Faddaoui A., Bachvarova M., Plante M., Gregoire J., Renaud M.C., Sebastianelli A., Gobeil S., Morin C., Macdonald E., Vanderhyden B, & Bachvarov D. (2016). The mannose receptor LY75 (DEC205/CD205) modulates cellular phenotype and metastatic potential of ovarian cancer cells. Oncotarget, 7(12), 14125-14142.

+ Open protocol

+ Expand

Bisulfite Sequencing Promoter Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite convertion was performed on 0.5 µg of genomic DNA from site-specific integrated cell clones using the MethylDetector Kit (ACTIVE MOTIF, 55001), according to the manufacturer’s instructions. Bisulfited-modified DNA was used to amplify the promoter fragments by nested PCR using Taq DNA polymerase (Kangwei, CW0680F), with the following conditions: 94 °C for 5 min, followed by 35 three-step cycles at 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 20 s. The PCR products of the first round were used as a template for second round amplification with the same condition. The final PCR products were separated on 2% agarose gels and purified, followed by TA cloning and sequencing. The presence of a cytosine residue after bisulfite treatment shows that the cytosine residue was protected from bisulfite modification by methylation. The primers were listed in Table S5.

Ma L., Wang Y., Wang H., Hu Y., Chen J., Tan T., Hu M., Liu X., Zhang R., Xing Y., Zhao Y., Hu X, & Li N. (2018). Screen and Verification for Transgene Integration Sites in Pigs. Scientific Reports, 8, 7433.

+ Open protocol

+ Expand

Analysis of ZBTB12 DNA Methylation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Buffy coats of peripheral blood cells were isolated from whole blood samples collected in sodium citrate EDTA tubes and centrifuged at 3000 rpm for 20 min at RT. DNA extraction was done using a silica matrix-based method as described [29 ]. Of the 754 Moli-family participants, 623 had good quality DNA samples to perform the methylation analysis. We measured ZBTB12 methylation using the Sequenom EpiTYPER MassARRAY (Agena) platform [15 (link)]. Details of the ZBTB12 region studied (chr6: 31899847-31900326, GRCh38/hg38 Assembly) are reported by Guarrera and colleagues [5 (link)]. Bisulfite treatment was conducted on 1 μg of genomic DNA using the MethylDetector kit (Active Motif) as described [15 (link)]. All PCR amplifications were performed in duplicate. For the CpG-specific analysis, data were discarded when the duplicate measurements had a standard deviation (SD) ≥ 5% [15 (link), 30 (link), 31 (link)]. Sequenom peaks with reference intensity > 2 and overlapping units were excluded from the analysis [15 (link), 30 (link), 31 (link)]. To exclude possible intra-plate differences, a sample of K562 DNA was carried on in each plate as an internal control.
Of the 20 CpG units included in the ZBTB12 region studied [5 (link)] (CGI1 in Fig. 1), we excluded the ones having more than 15% of missing values in the Moli-family cohort, leading to a total of 13 CpG (Table 1).

Noro F., Gianfagna F., Gialluisi A., De Curtis A., Di Castelnuovo A., Napoleone E., Cerletti C., Donati M.B., de Gaetano G., Hoylaerts M.F., Iacoviello L, & Izzi B. (2019). ZBTB12 DNA methylation is associated with coagulation- and inflammation-related blood cell parameters: findings from the Moli-family cohort. Clinical Epigenetics, 11, 74.

+ Open protocol

+ Expand

DNA Methylation Analysis of Lta Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

DCs were FACS-sorted as CD11c⁺CD11b⁻ from DLNs of naïve and EAE mice at 9-dpi. Genomic DNA was obtained with the GenElute^TM Mammalian Genomic DNA Miniprep kit (Sigma). Bisulfite conversion was performed with the MethylDetector kit (Active Motif), and the Lta promoter (between −363-nt and +65-nt from the transcription start site) was cloned into the pCR4-TOPO-TA vector (Life Technologies) and transformed into E. coli. Methylation status was evaluated by sequencing 17–22 clones per group. Percentages of unmethylated CpG in all the tested CpG sites were calculated.

Inoue M., Chen P.H., Siecinski S., Li Q.J., Liu C., Steinman L., Gregory S.G., Benner E, & Shinohara M.L. (2016). Mechanism to develop inflammasome-independent and interferon-β-resistant EAE with neuronal damages. Nature neuroscience, 19(12), 1599-1609.

+ Open protocol

+ Expand

Profiling Epigenetic Modifications in Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was purified with GenElute Mammalian Genomic DNA Miniprep Kit (Sigma, Cat. G1N79). Methylation analysis was quantified by sequencing of genomic DNA after bisulfite conversion with the MethylDetector kit (Active Motif), PCR amplification, and cloning. ChIP assays were performed with a standard protocol with anti-H3Ac, anti-H3K4me2, anti-H3K4me3, and anti-H3K27me3 rabbit polyclonal antibodies (Millipore), anti-MeCP2 (D4F3) XP rabbit monoclonal antibody (Cell Signaling), or a nonspecific rabbit anti-mouse immunoglobulin G (IgG, Jackson ImmunoResearch Laboratories). The amount of DNA immunoprecipitated by antibodies was quantified by quantitative PCR with primers specific for the indicated gene regulatory regions and normalized to the amount of input DNA before immunoprecipitation. For MeCP2 ChIP assays, the ratio of enrichment was determined by normalizing the amount of DNA immunoprecipitated with rabbit anti-MeCP2 antibody to that immunoprecipitated with nonspecific rabbit IgG.

Jiang S., Li C., McRae G., Lykken E., Sevilla J., Liu S.Q., Wan Y, & Li Q.J. (2014). MeCP2 Reinforces STAT3 Signaling and the Generation of Effector CD4+ T Cells by Promoting miR-124–Mediated Suppression of SOCS5. Science signaling, 7(316), ra25.

+ Open protocol

+ Expand

Bisulfite DNA Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted using the DNeasy Kit (Qiagen, 69504). The MethylDetector kit (Active Motif, 55001) was used to generate bisulfite-modified DNA. The modified DNA was purified and used as the template for nested PCR reactions with the following primers: outer primers, 5′-ATTCGAATTTAGTGGAATTAGAATC-3′ (forward) and 5′-AACCTACAACAACAACAACAACG-3′ (reverse); nested primers, 5′-TTAGTAATTTTAGGTTAGAGGGTTATCG-3′ (forward) and 5′-ACTCCAAAAACCCATAACTAACCG-3′ (reverse). The second-round PCR products were subcloned into the TOPO cloning vector (Invitrogen, K4600-01) and clones were randomly picked for DNA sequencing.

Chen D., Sun Y., Yuan Y., Han Z., Zhang P., Zhang J., You M.J., Teruya-Feldstein J., Wang M., Gupta S., Hung M.C., Liang H, & Ma L. (2014). miR-100 Induces Epithelial-Mesenchymal Transition but Suppresses Tumorigenesis, Migration and Invasion. PLoS Genetics, 10(2), e1004177.

+ Open protocol

+ Expand

Quantitative DNA methylation analysis of key genes

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulphite treatment was conducted on 1 μg of genomic DNA using the Methyl Detector kit (Active Motif, Carlsbad, CA, USA) according to the manufacturer’s instructions, except for the incubation protocol during the conversion, performed for a total of 16h as described [83 (link)]. Amplicons to study PEAR1 are already described [53 (link)]. Amplicons to study RNNAD1 and ISG20L2, HDGF and PRCC methylation were designed using the Sequenom (Agena) EpiDesigner software (http://www.epidesigner.com/). Primers and amplicons characteristics are reported in Supplemental Table S2. All PCR amplifications were performed in triplicate. For the CpG- specific analysis, when the triplicate measurements had a SD equal to or greater than 10%, data were discarded. Sequenom (Agena) peaks with reference intensity above 2, overlapping and duplicate units were excluded from the analysis [84 (link),85 (link)].

Izzi B., Noro F., Cludts K., Freson K, & Hoylaerts M.F. (2018). Cell-Specific PEAR1 Methylation Studies Reveal a Locus that Coordinates Expression of Multiple Genes. International Journal of Molecular Sciences, 19(4), 1069.

+ Open protocol

+ Expand

DNA Methylation Analysis of Regulatory T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PBMCs were stimulated as described in the above section: ‘In vitro stimulation of T cells and intracellular cytokine staining (ICS)’. After staining, TNF-α⁺Foxp3⁺, TNF-α⁻Foxp3⁺, and Foxp3⁻ cell populations were isolated from the gate of viable CD4⁺ T cells using a FACSAria II cell sorter (BD Biosciences). The purity of sorted cells was more than 95%.
The sorted cells were analyzed for DNA methylation status of the Treg-specific demethylated region (TSDR). DNA methylation analysis was performed as previously described.^{29 (link)} Genomic DNA was extracted from sorted cells using a DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA) according to the manufacturer’s instruction. Purified DNA was subjected to sodium bisulfite conversion using a MethylDetector kit (Active Motif, Carlsbad, CA). Following bisulfite conversion, the CpG island of TSDR was amplified by nested PCR (primer pairs used: 5′-TGT GGA GTT TGT TTG GTA TTT TTA G and 5′-AAA AAT TCT CCC CAA ACA CAT ATA A for direct round; 5′-TGG GTT AAG TTT GTT GTA GGA TAG G and 5′-TCC CTT TCT AAC TAA ATT TCT CAA AAA C) for the nested round. The final PCR product of 257 base pairs was purified and cloned into the TOPO TA cloning vector (Invitrogen), and the methylation status of CpG loci in each cell population was ascertained by automatically sequencing more than ten clones from each experiment.

Choi Y.S., Jung M.K., Lee J., Choi S.J., Choi S.H., Lee H.W., Lee J.J., Kim H.J., Ahn S.H., Lee D.H., Kim W., Park S.H., Huh J.R., Kim H.P., Park J.Y, & Shin E.C. (2017). Tumor Necrosis Factor-producing T-regulatory Cells are Associated With Severe Liver Injury in Patients With Acute Hepatitis A. Gastroenterology, 154(4), 1047-1060.

+ Open protocol

+ Expand

Methylation Analysis of PEAR1 Gene

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

PEAR1 (CGI1) methylation was evaluated using the Sequenom EpiTYPER MassARRAY (Agena) platform as described [30 (link), 40 (link), 41 (link)] on white blood cell DNA from 605 Moli-family and 1002 FLEMENGHO participants.
Bisulfite treatment was conducted on 1 μg of genomic DNA using the MethylDetector kit (Active Motif) according to the manufacturer’s instructions, except for the incubation protocol during the conversion, performed for a total of 16 h as described [70 (link)]. The amplicon to study PEAR1 methylation was designed using the Sequenom EpiDesigner software (http://www.epidesigner.com/) [30 (link)]. All PCR amplifications were performed in duplicate. For the CpG-specific analysis, data were discarded when the duplicate measurements had a SD equal to or greater than 5% [30 (link), 40 (link), 41 (link)]. Sequenom peaks with reference intensity above 2 and overlapping units were excluded from the analysis [30 (link), 40 (link), 41 (link)]. To exclude possible intra-plate differences, a sample of K562 DNA, with known PEAR1 methylation profile (around 90%), was carried on in each plate.

Izzi B., Gianfagna F., Yang W.Y., Cludts K., De Curtis A., Verhamme P., Di Castelnuovo A., Cerletti C., Donati M.B., de Gaetano G., Staessen J.A., Hoylaerts M.F, & Iacoviello L. (2019). Variation of PEAR1 DNA methylation influences platelet and leukocyte function. Clinical Epigenetics, 11, 151.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!