Sc 418922

Manufactured by Santa Cruz Biotechnology

Sourced in United States

Sc-418922 is a laboratory equipment product manufactured by Santa Cruz Biotechnology. It is designed to facilitate specific research and experimental procedures. The core function of this product is to provide a reliable and efficient tool for researchers working in the field of biotechnology. Further details on the intended use or specific applications of Sc-418922 are not available.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions) Sc 427066, by Thermo Fisher Scientific (2 mentions) Sc 427066 hdr, by Thermo Fisher Scientific (2 mentions) Sc 437275, by Santa Cruz Biotechnology (2 mentions) Sc 400316, by Santa Cruz Biotechnology (2 mentions) Okt3 86022706, by Merck Group (2 mentions) Sc 400316 act, by Santa Cruz Biotechnology (2 mentions) Sc 7212, by Santa Cruz Biotechnology (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Microliter 701, by Hamilton Company (1 mentions) Sh800 sorter, by Sony (1 mentions) Ultracruz transfection reagent, by Santa Cruz Biotechnology (1 mentions) Ab128171, by Abcam (1 mentions) Neon electroporator, by Thermo Fisher Scientific (1 mentions) Fluorescence activated cell sorting (facs), by BD (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) L glutamine, by Thermo Fisher Scientific (1 mentions) Sc 395739, by Santa Cruz Biotechnology (1 mentions) Crl 3243, by American Type Culture Collection (1 mentions) Pcs 201 012, by American Type Culture Collection (1 mentions)

19 protocols using sc 418922

CRISPR-Cas9 Editing of Phf5a in ESCs and C2C12

Check if the same lab product or an alternative is used in the 5 most similar protocols

For CRISPR-Cas9 editing Control- and Phf5a-targeting and repair template vectors were purchased from SantaCruz (sc-418922, sc-427066, sc-427066-HDR) and were transfected in ESCs or C2C12 cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s manual.

Strikoudis A., Lazaris C., Trimarchi T., Neto A.L., Yang Y., Ntziachristos P., Rothbart S., Buckley S., Dolgalev I., Stadtfeld M., Strahl B.D., Dynlacht B.D., Tsirigos A, & Aifantis I. (2016). Regulation of transcriptional elongation in pluripotency and cell differentiation by the PHD-finger protein Phf5a. Nature cell biology, 18(11), 1127-1138.

+ Open protocol

+ Expand

Intracerebroventricular CRISPR Injection for SAH

Check if the same lab product or an alternative is used in the 5 most similar protocols

An intracerebroventricular injection was conducted as described before [42 (link)]. Animals were kept in a stereotaxic apparatus with 3% isoflurane mixed air (70% medical air/30% oxygen) anesthesia. A burr hole was drilled on the skull at the following coordinates relative to bregma: 1.5 mm posterior and 1.0 mm lateral. The needle of a 10 μl Hamilton syringe (Microliter 701, Hamilton Company, Reno, NV, USA) was inserted through the burr hole into the left lateral ventricle at a depth of 3.3 mm. The speed of infusion was maintained at 1 μl/min using an infusion pump (Stoelting, Harvard Apparatus, Holliston, MA, USA). A total of 2 μg knockout or activation CRISPR was delivered intracerebroventricularly (i.c.v). EP3 KO CRISPR (sc-422482, Santa Cruz Biotechnology, Dallas, TX, USA), FOXO3 activation CRISPR (sc-425192-ACT, Santa Cruz Biotechnology, Dallas, TX, USA), or scramble CRISPR (sc-418922, Santa Cruz Biotechnology, Dallas, TX, USA) was injected into the cerebroventricle 48 h prior to SAH induction.

Liu Y., Liu R., Huang L., Zuo G., Dai J., Gao L., Shi H., Fang Y., Lu Q., Okada T., Wang Z., Hu X., Lenahan C., Tang J., Xiao J, & Zhang J.H. (2022). Inhibition of Prostaglandin E2 Receptor EP3 Attenuates Oxidative Stress and Neuronal Apoptosis Partially by Modulating p38MAPK/FOXO3/Mul1/Mfn2 Pathway after Subarachnoid Hemorrhage in Rats. Oxidative Medicine and Cellular Longevity, 2022, 7727616.

+ Open protocol

+ Expand

CRISPR-mediated IRE1α Knockout in CT26 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the generation of stable CT26 cells with invalidated IRE1α, cells were transfected with 3 μg of CRISPR-Cas9-expressing knockout plasmids (control, sc-418922 and IRE1α, sc-429758 from Santa Cruz) using the jetPEI DNA transfection reagent (PolyPlus Transfection, #POL101-10 N) as described by the manufacturer. The knockout plasmid was a mixture of three plasmids, each carrying a different guide RNA specific to the target gene and to the Cas- and GFP-coding regions. Transient GFP positive cells were selected by sorting (SONY sorter SH800, Sony Biotechnology) 24 h after transfection. IRE1α knockout (KO) was verified by immunoblotting.

Martinez-Turtos A., Paul R., Grima-Reyes M., Issaoui H., Krug A., Mhaidly R., Bossowski J.P., Chiche J., Marchetti S., Verhoeyen E., Chevet E, & Ricci J.E. (2022). IRE1α overexpression in malignant cells limits tumor progression by inducing an anti-cancer immune response. Oncoimmunology, 11(1), 2116844.

+ Open protocol

+ Expand

Inhibition of CCR5 and JAK2 in ICH

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

MVC, an FDA-approved selective CCR5 antagonist [14 (link)], was purchased from Selleck Chemicals and dissolved in 1% dimethyl sulfoxide (DMSO). The mice were administered 100 mg/kg MVC via i.p. injection 25 h before, 2 h after and 23 h after ICH [22 (link)]. rCCL5 (0.5 μg/mouse; 478-MR-025; R&D Systems) was dissolved in the same vehicle and intraperitoneally injected into mice 25 h before, 2 h after and 23 h after ICH [12 (link)]. To specifically knockdown JAK2 expression, mice were administered a JAK2 CRISPR knockout plasmid (2 μl/mouse; sc-421200; Santa Cruz Biotechnology, Shanghai, China) or control CRISPR plasmid (2 μl/mouse; sc-418922; Santa Cruz Biotechnology, Shanghai, China) via intracerebroventricular (i.c.v.) injection 25 h before ICH induction [23 (link)].

Lin J., Xu Y., Guo P., Chen Y.J., Zhou J., Xia M., Tan B., Liu X., Feng H, & Chen Y. (2023). CCL5/CCR5-mediated peripheral inflammation exacerbates blood‒brain barrier disruption after intracerebral hemorrhage in mice. Journal of Translational Medicine, 21, 196.

+ Open protocol

+ Expand

CRISPR-mediated Modulation of Telomerase in Primary T cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary human CD3⁺ CD4⁺ CD27⁺ CD28⁺ T cells (5 x 10⁶) were transfected with 3mg of TERT KO CRISPR/Cas9 plasmid (h) (sc-400316, Santa Cruz Biotechnology) according to the manufacturer instructions. TERT-KO (GFP⁺) T cells were then activated by anti-CD3 (0.5 μg/ml; OKT3 86022706 Sigma Aldrich used throughout) plus anti-CD28 (0.5 μg/mL; 37407 MAB342 R&D systems used throughout) and then purified by FACS 96h post-transfection. Control primary human CD3⁺ CD4⁺ CD27⁺ CD28⁺ T cells were transfected with 3mg of control CRISPR/Cas9 Plasmid (sc-418922, Santa Cruz Biotechnology). Knock-out efficiency was confirmed by qPCR (Hs00972656_m1; TaqMan). Transcript expression was normalized to that of the housekeeping gene GAPDH by the change-in-cycling-threshold method (ΔΔCt) for the calculation of values supplied by Applied Biosystems. In experiments with telomerase enhancement, 10⁷ primary human CD3⁺ CD4⁺ CD27⁺ CD28⁺ T cells were transfected with 3 μg of CRISPR telomerase activation particles (sc-400316-ACT, Santa Cruz Biotechnology) and then used 96h post transfection. For immunoblots to TERT (1:1000; sc-7212, Santa Cruz Biotechnology) on purified GFP⁺ primary human T cells was used as previously described¹. Control was control CRISPR/Cas9 Plasmid as advised by the manufacturer (sc-437275, Santa Cruz Biotechnology).

Lanna A., Vaz B., D’Ambra C., Valvo S., Vuotto C., Chiurchiù V., Devine O., Sanchez M., Borsellino G., Akbar A.N., De Bardi M., Gilroy D.W., Dustin M.L., Blumer B, & Karin M. (2022). An intercellular transfer of telomeres rescues T cells from senescence and promotes long-term immunological memory. Nature cell biology, 24(10), 1461-1474.

+ Open protocol

+ Expand

Generation of DRD2 Knockout Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

ARK2 cells were co-transfected with DRD2 CRISPR/Cas9 KO plasmid (sc-400235-KO-2, Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and DRD2 HDR plasmid (sc-400235-HDR-2, Santa Cruz Biotechnology, Inc.), and selected for with puromycin to generate DRD2 knockout (DRD2-KO) cells. Control CRISPR/Cas9 plasmid (sc-418922, Santa Cruz Biotechnology, Inc.) was also transfected to generate control knockout (Control-KO) cells as a negative control. Single DRD2-KO and Control-KO cells, which were RFP positive, were isolated using a cell sorting technique. The knockout efficiency was verified using quantitative reverse transcription PCR analysis.

Hu W., Zhang L., Ferri-Borgogno S., Kwan S.Y., Lewis K.E., Cun H.T., Yeung T.L., Soliman P.T., Tarapore R.S., Allen J.E., Guan X., Lu K.H., Mok S.C, & Au-Yeung C.L. (2020). Targeting Dopamine Receptor D2 by Imipridone Suppresses Uterine Serous Cancer Malignant Phenotype. Cancers, 12(9), 2436.

+ Open protocol

+ Expand

CRISPR-Cas9 Editing of Phf5a in ESCs and C2C12

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

CRISPR-mediated p120 Knockout in 4T1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

4T1 cells were transfected using Lipofectamine 2000 (Invitrogen) 24 hours after plating with 2 µg of a pool of three p120 CRISPR Cas9 KO constructs. Each of these constructs encodes a Cas9 nuclease and GFP driven by a chicken β-actin hybrid promoter, and one of the following gRNAs under the control of a U6 promoter, and derived from the GeCKO v2 library: gRNA1 TCTGGTCCGATTGCTCCGAA, gRNA2 TGTGGTCTCCGTGCGTCTAG, gRNA3 TGATGGGACCACTAGACGCA targeting three different sites in the Ctnnd1 gene (Santa Cruz sc-419478). As a control, cells were transfected with a non-targeting scrambled gRNA construct (Santa Cruz sc-418922). Media were changed 6 h after transfection, and after growth for an additional 72 h in antibiotics-free medium, single GFP-expressing cells were collected in a 96 wells plate using a DB Aria flow cytometry sorter and grown for 3 weeks until colonies appeared. P120 KO colonies were selected after 3 weeks based on Western blot analysis.

Venhuizen J.H., Sommer S., Span P.N., Friedl P, & Zegers M.M. (2019). Differential expression of p120-catenin 1 and 3 isoforms in epithelial tissues. Scientific Reports, 9, 90.

+ Open protocol

+ Expand

KCTD15 Silenced SKBR3 Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

The KCTD15 silenced SKBR3 cell line was obtained using the CRISP/CAS9 technology. In brief, SKBR3 cells were transfected with KCTD15 double nickase plasmid (sc-407663-NIC-2, Santa Cruz Biotechnology, Inc. USA) to obtain KCTD15 silenced clones (SKBR3^KCTD15−). In addition, to generate control cells (SKBR3^ctrl), SKBR3 cells were transfected with CRISP/CAS9 control plasmid (sc-418922, Santa Cruz Biotechnology, Inc. USA) plus pReceiver-M94 plasmid (GeneCopeia, USA). Transfections were conducted using Lipofectamine 3000 reagent (L3000001, Thermo Fisher Scientific, USA) following manufacturer instructions.

Smaldone G., Coppola L., Pane K., Franzese M., Beneduce G., Parasole R., Menna G., Vitagliano L., Salvatore M, & Mirabelli P. (2021). KCTD15 deregulation is associated with alterations of the NF-κB signaling in both pathological and physiological model systems. Scientific Reports, 11, 18237.

+ Open protocol

+ Expand

Investigating HSP40 CRISPR/Cas9 Knockout in PC-3 Cell Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfection of plasmid DNA into PC-3 cells was carried out using UltraCruz transfection reagent according to the manufacture's protocol (Santa Cruz, Dallas, Texas) in Opti-MEM reduced serum media. PC-3 cells were transfected with 1 μg of HSP40 CRISP/Cas9 knockout (KO) (sc-418922, Santa Cruz), and Control CRISP/Cas9 (sc-418922, Santa Cruz) DNA Plasmids. To assess the effect of HSP40CRISP/Cas KO on cell proliferation we plated 5 × 10⁵ PC-3 cells into 6 well plates and transfected the cells with vector control, HSP40 KO plasmid, and treated with ethanol, and 20 μg/ml MSKE compared with untreated control for 24 and 48 hr. Trypan blue exclusion assay used for cell proliferation, western analysis described above was used for detection of proteins, and CytoSelect^™ 24-Well Cell Invasion Assay kit used for migration assay.

Ignacio D.N., Mason K.D., Hackett-Morton E.C., Albanese C., Ringer L., Wagner W.D., Wang P.C., Carducci M.A., Kachhap S.K., Paller C.J., Mendonca J., Li-Ying Chan L., Lin B., Hartle D.K., Green J.E., Brown C.A, & Hudson T.S. (2019). Muscadine grape skin extract inhibits prostate cancer cells by inducing cell-cycle arrest, and decreasing migration through heat shock protein 40. Heliyon, 5(1), e01128.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!