Firefly luciferase mRNA (FLuc mRNA, 1929 nucleotides, CleanCap® FLuc mRNA), FLuc mRNA modified with 5-methoxyuridine (FLuc mRNA (5moU), 1929 nucleotides, CleanCap® FLuc mRNA (5moU)), enhanced green fluorescent protein mRNA (EGFP mRNA, 996 nucleotides, CleanCap® EGFP mRNA), cyanine 5 (Cy5)-labeled FLuc mRNA modified with 5-methoxyuridine (Cy5-mRNA (5moU), CleanCap® Cyanine 5 FLuc mRNA (5moU)), and ovalbumin mRNA modified with 5-methoxyuridine (OVA mRNA, 1437 nucleotides, CleanCap® OVA (5moU) mRNA) were obtained from TriLink Biotechnologies (CA, USA). EZCapTM Cyanine 5 FLuc mRNA (5moU) (Cy5-mRNA (5moU), 1921 nucleotides) was obtained from ApexBio Technology LLC (Boston, MA, USA).
Cleancap fluc mrna
Manufactured by TriLink
Sourced in United States
CleanCap Fluc mRNA is a laboratory product designed for in vitro transcription of mRNA. It provides a capping solution to produce capped mRNA for research purposes.
Automatically generated - may contain errors
Lab products found in correlation
Cleancap egfp mrna, by TriLink (2 mentions)
Cleancap cyanine 5 fluc mrna, by TriLink (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Cacl2, by Thermo Fisher Scientific (1 mentions)
Mgcl2, by Thermo Fisher Scientific (1 mentions)
Cy5 mrna, by TriLink (1 mentions)
Lysotracker green, by Thermo Fisher Scientific (1 mentions)
Cleancap mcherry mrna, by TriLink (1 mentions)
Hek293t cell, by American Type Culture Collection (1 mentions)
Hela cell, by American Type Culture Collection (1 mentions)
Quant it ribogreen reagent, by Thermo Fisher Scientific (1 mentions)
E coli poly a polymerase kit, by New England Biolabs (1 mentions)
Cleancap technology, by TriLink (1 mentions)
Rneasy rna purification kit, by Qiagen (1 mentions)
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
6 protocols using cleancap fluc mrna
1
Modified mRNA Molecules for Bioimaging
2
In Vitro Synthesis and Methylation of Bicistronic Firefly-Renilla mRNA
3
In vitro mRNA Synthesis and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA synthesis via in vitro transcription
was performed using linearized plasmid DNA with a High Scribe T7 Polymerase
HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs): 10
mM NTPs (final concentration), a 1× reaction buffer, 1 μg
of a DNA template, and 2 μL of HiScribe T7 polymerase in 20
μL of RNase-free water. eGFP mRNA was prepared using a DNA template
containing the open reading frame flanked by the 5′ and 3′
untranslated regions (UTR) and a poly-A tail. SARS CoV-2 spike protein
mRNA was prepared using a DNA template containing the open reading
frame flanked by the 5′ and 3′ UTR. Following IVT, template
DNA was removed by the addition of DNase I and RNA was purified using
silica columns as previously described.23 (link) RNA concentrations were determined using a NanoDrop 2000c spectrophotometer
(ThermoFisher Scientific) by absorbance at 260 nm normalized to a
1.0 cm (10.0 mm) path. Additional analysis of the RNA was subsequently
performed using ion pair reverse-phase chromatography to assess the
purity of the RNA. CleanCap Fluc mRNA and CleanCap Fluc mRNA (5-methoxyuridine)
were purchased from TriLink Biotechnologies.
was performed using linearized plasmid DNA with a High Scribe T7 Polymerase
HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs): 10
mM NTPs (final concentration), a 1× reaction buffer, 1 μg
of a DNA template, and 2 μL of HiScribe T7 polymerase in 20
μL of RNase-free water. eGFP mRNA was prepared using a DNA template
containing the open reading frame flanked by the 5′ and 3′
untranslated regions (UTR) and a poly-A tail. SARS CoV-2 spike protein
mRNA was prepared using a DNA template containing the open reading
frame flanked by the 5′ and 3′ UTR. Following IVT, template
DNA was removed by the addition of DNase I and RNA was purified using
silica columns as previously described.23 (link) RNA concentrations were determined using a NanoDrop 2000c spectrophotometer
(ThermoFisher Scientific) by absorbance at 260 nm normalized to a
1.0 cm (10.0 mm) path. Additional analysis of the RNA was subsequently
performed using ion pair reverse-phase chromatography to assess the
purity of the RNA. CleanCap Fluc mRNA and CleanCap Fluc mRNA (5-methoxyuridine)
were purchased from TriLink Biotechnologies.
4
mRNA Delivery and Quantification Using Cationic Peptide
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNAs: Anti-reverse cap analogue (ARCA) mRNA encoding enhanced green fluorescent protein (EGFP), i.e., EGFP-mRNA (5-moUTP), ARCA Cy5-labeled EGFP-mRNA (5mo-UTP), and CleanCap mCherry-mRNA (5mo-UTP) were purchased from APExBIO Technology (Houston, TX, USA), and CleanCap Fluc-mRNA, i.e., luciferase-mRNA (5moU) from TriLink Biotechnologies (San Diego, CA, USA). The mRNA stock solutions (1 mg/mL) were maintained at −80°C.
PF14 (stearyl-AGYLLGKLLOOLAAAALOOLL-NH2) (PepScan, Lelystad, Netherlands and PepMic, Shanghai, China). 1 mM peptide stock solution was prepared in the mixture of ethanol, DMSO, and trimethylene carbonate (TMC) (90:9.6:0.4 v:v:v) and stored at −20°C. Luciferase substrate XenoLight D-Luciferin – K+ salt (LH2) was obtained from PerkinElmer (Waltham, MA, USA), CaCl2 and MgCl2 from Thermo Fisher Scientific (Waltham, MA, USA), PS80 from VWR (Radnor, PA, USA) and chloroquine from Applichem (Darmstadt, Germany). The cell lysis buffer contained 1% (v:v) Triton X-100, 50 mM Tris (pH 7.5), 150 mM NaCl, and 1 mM EDTA. Luciferase substrate solution contained 1 mM LH2, 25 mM DTT, 1 mM ATP, 25 μM coenzyme A, 5 mM MgSO4, 20 mM tricine, 1 mM EDTA, and 1 mM MgCO3.
PF14 (stearyl-AGYLLGKLLOOLAAAALOOLL-NH2) (PepScan, Lelystad, Netherlands and PepMic, Shanghai, China). 1 mM peptide stock solution was prepared in the mixture of ethanol, DMSO, and trimethylene carbonate (TMC) (90:9.6:0.4 v:v:v) and stored at −20°C. Luciferase substrate XenoLight D-Luciferin – K+ salt (LH2) was obtained from PerkinElmer (Waltham, MA, USA), CaCl2 and MgCl2 from Thermo Fisher Scientific (Waltham, MA, USA), PS80 from VWR (Radnor, PA, USA) and chloroquine from Applichem (Darmstadt, Germany). The cell lysis buffer contained 1% (v:v) Triton X-100, 50 mM Tris (pH 7.5), 150 mM NaCl, and 1 mM EDTA. Luciferase substrate solution contained 1 mM LH2, 25 mM DTT, 1 mM ATP, 25 μM coenzyme A, 5 mM MgSO4, 20 mM tricine, 1 mM EDTA, and 1 mM MgCO3.
5
mRNA Transfection and Luminescence Assay
6
Preparation of Fluorescent mRNA Reporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cy5-labelled EGFP mRNA, modified with 5-methoxyuridine, capped using CleanCap technology, and polyadenylated were purchased from Trilink Biotechnologies (San Diego, CA, USA). The length of the mRNA was 996 nucleotides, and Cy5-EGFP mRNA contained a 3:1 methoxyuridine ratio with Cy5. NanoLuc mRNA was obtained by in vitro transcription using the T7 HighScribe kit (ThermoFisherScientific, Waltham, MA, USA) according to manufacturer’s specifications, with 200 ng of purified PCR product (F primer: AATTAATACGACTCACTATAGGGATACGCCGCCACCATGAACTCCTTCTCCACAAGC, R primer: GTATCTTATCATGTCTGCTCGAAG, Q5-high fidelity polymerase (NEB, Ipswich, MA, USA), purified with MinElute PCR purification kit (Qiagen Benelux, Venlo, The Netherlands)) as input. NanoLuc mRNA was capped with Vaccinia Capping enzymes (NEB) and extended with a 250 nt poly-A-tail (E. coli polyA polymerase kit, NEB) according to manufacturer’s specifications. Final purification of the mRNA was performed using the RNeasy RNA purification kit (Qiagen) according to manufacturer’s specifications, with elution in RNAse-free MQ. All mRNA was stored at 1 µg/µL in MQ at −80 °C until use. Before use, the mRNA solution was thawed at RT and stored on ice. CleanCap-Fluc mRNA was purchased from TriLink Biotechnologies (San Diego, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!