Plko 1 shscr

The MDA MB231 and MDA MB157 breast cancer cell lines, the A549 lung cancer cell line (ATCC), and the viral packaging 293T cell line were maintained in DMEM supplemented with 10% (v/v) fetal bovine serum and antibiotics. H157, H1299, HCC827 parental, and the Met overexpressing HCC827-GR5 lung cancer cell lines (ATCC). HCC827-GR5 was gift from Prof Pasi Janneand developed to be resistant to Gefitinib by amplification of Met gene were maintained in RPMI supplemented with 10% (v/v) fetal bovine serum and antibiotics. The Ras-transformed MCF10A derivative MCF10AT cell line (from Karmanos Cancer Centre, Detroit, MI) was maintained in DMEM/F-12 containing 5% horse serum, 10 μg/ml insulin, 20 ng/ml EGF, 100 ng/ml (v/v) choleratoxin, and 0.5 μg/ml hydrocortisone.
Transfection was performed using GeneJuice® (Promega, Southampton, UK) according to the manufacturer's instructions. pLKO.1-shScr and pLKO.1-shRan5 (CCGGCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTGTTTTTTG; Sigma-Aldrich, Dorset, UK) were used for to knockdown Ran by Lentiviral infection, as previously described [5 (link)].

For lentivirus production, HEK293T cells were co-transfected with Lentiviral vector pLKO.1-shScr (Scramble control), pLKO.1-shFTO-A (Sigma) targeting FTO gene and packaging plasmids (TR30037, Origene) using TurboFectin transfection reagent (Origene). 24 h after transfection, media was changed and after another 48 h, cell supernatants were harvested, centrifuged, and filtered to collect lentiviral particles. Next, HCT116 cells were transduced with packaged lentiviral particles in the presence of polybrene (8 µg/ml) using the spinoculation method at 1000 g for 1 h. For stable cell line generation, transduced cells were selected with 2 μg/ml puromycin beginning 48 h after infection and maintained under selection for 2-3 passages.