All common reagents were purchased from Sigma-Aldrich (St.Louis, MO), unless otherwise mentioned. The following antibodies were used: mouse monoclonal GM130 (BD Transduction Laboratories), goat polyclonal GRASP65 (Santa Cruz Biotechnology, CA), rabbit polyclonal GRASP55 (Proteintech inc., Chicago,IL), HRP-conjugated mouse β-actin antibody (Genscript, Piscataway, NJ). Rabbit polyclonal Syntaxin5 (Synaptic system, Goettingen, Germany). Rabbit polyclonal Golgin45 antibody was made by injecting synthetic Golgin45 peptide (AA40-53) conjugated to KLH (GenScript, Piscataway, NJ). All siRNA oligos were purchased from Integrated DNA Technology (Coralville, IA) and the target sequences were as following: human Golgin45 (GCATCATAGTCTTCAGAGTCCATGG), Human Golgin45 (5′UTR for rescue experiments) (CGGAGAAUAAGAAUCUUAGAGGU), Human GM130 (GGACAATGCTGCTACTCTACAACCA), GRASP55 oligo#1 (CTGCGAGAGACCTCAGTCACACCAA), GRASP55 oligo#2 (CCACCAGGAACTACAGGAATTGAAC), GRASP65 oligo#1 (CCTGAAGGCACTACTGAAAGCCAAT), GRASP65 oligo#2 (CTGGGATGTGGCATTGGCT ATGGGT). Rat GM130 cDNA was obtained from Nobuhiro Nakamura (Kyoto Sangyo University, Kyoto, Japan). Human Golgin45 cDNA was purchased from Addgene (Cambridge,MA).
Syntaxin5
Manufactured by Synaptic Systems
Syntaxin5 is a protein involved in the regulation of vesicle trafficking and membrane fusion processes within cells. It serves as a core component of the SNARE complex, which mediates the docking and fusion of transport vesicles with their target membranes. Syntaxin5 plays a crucial role in the organization and functioning of the Golgi apparatus and endoplasmic reticulum, facilitating the transport and delivery of cargo within the cell.
Automatically generated - may contain errors
Lab products found in correlation
Grasp55, by Proteintech (2 mentions)
Grasp65, by Santa Cruz Biotechnology (1 mentions)
Ergic3, by Abcam (1 mentions)
Trans blot turbo transfer system, by Bio-Rad (1 mentions)
Rela p65, by Cell Signaling Technology (1 mentions)
Vamp3, by Synaptic Systems (1 mentions)
Golgin 97, by Thermo Fisher Scientific (1 mentions)
Anti rabbit conjugated to alexa fluor 488, by Thermo Fisher Scientific (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
Vamp8, by Synaptic Systems (1 mentions)
3 protocols using syntaxin5
1
Molecular Toolkit for Golgi Apparatus Research
2
Western Blot Analysis of Membrane Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein samples were separated via SDS-PAGE in a 10 % polyacrylamide gel at 160V. Afterwards proteins were transferred onto nitrocellulose membranes using the Trans-Blot Turbo transfer system (BioRad, 1704270, 1704159). Nitrocellulose membranes were blocked at RT in blocking solution containing 5% milk powder in TBST (20mM Tris pH 7.5, 150mM NaCl, 0.2 % Tween) and incubated in the primary antibody (diluted in blocking solution, Cx36 1:500, ThermoFisher, 37–4600, RRID:AB_2533320; Tubulin 1:1000, Abnova, MAB12827; Grasp55 1:1000, Proteintech, 10598–1-AP; GFP, 1:1000, Cell Signaling Technology, 2956, RRID:AB_1196615; V5 1:1000, ThermoFisher, R960–25, RRID:AB_2556564; Syntaxin5 1:5000, Synaptic Systems, 110 053; Sec24A 1:500, ThermoFisher, PA5–66043; Sec24B 1:10000, Bethyl Laboratories, A304–876A, RRID:AB_2621071; Ergic3 1:5000, Abcam, ab129179, RRID:AB_11141068; Sec24C 1:500, ThermoFisher, PA5–59101; GOPC: 1:1000, ThermoFisher, PA5–110897, RRID:AB_2856308) overnight at 4°C on a rotating platform. At the next day blots were washed 3x with TBST for 10 min and incubated with HRP conjugated secondary antibodies (goat anti mouse HRP, 1:1000, 34130 and goat anti rabbit, 1:1000, 34160, Thermofisher) for 1h. Nitrocellulose membranes were washed 3x with TBST and incubated for 1 min in ECL substrates (Thermofisher, 32106) for chemiluminescence detection.
3
Antibody Sources for Protein Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rabbit polyclonal antibodies against Syntaxin-5, VAMP3, and VAMP8 were obtained from Synaptic Systems; rabbit polyclonal against β-actin, p65RelA, and mTOR from Cell Signaling; rabbit polyclonal anti-c-Jun from Santa Cruz Biotechnology; mouse monoclonal anti-SHP-1 from Abcam; mouse monoclonal antibody anti-NLRP3 from AdipoGen Life Sciences; mouse monoclonal antibodies against Calnexin and Golgin 97 from Invitrogen. The rabbit anti-Syt XI polyclonal antibody [59 (link)] was kindly provided by Dr Mitsunori Fukuda (Tohoku University). The rabbit polyclonal antibodies anti-PTP-PEST 2530 [60 (link)] were kindly provided by Dr Michel L. Tremblay (McGill University). The secondary HRP-conjugated antibodies anti-mouse and anti-rabbit were obtained from Sigma Aldrich. The secondary antibody anti-rabbit conjugated to AlexaFluor 488 and the secondary antibody goat anti-mouse conjugated to AlexaFluor 568 used for immunofluorescence were from Invitrogen-Molecular probes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!