Scramble shrna

To silence RAP2 expression, pLKO.1 TRC cloning vector (Plasmid 10878; Addgene, Watertown, USA) was used and the sequence of 21 bp target against RAP2 was 5′-CGGCACCTTCATCGAGAAATA-3′, and Scramble shRNA (plasmid 1864; Addgene) was used as the control vector. The sequence of 21 bp target against c-Myc was 5′-CCTGAGACAGATCAGCAACAA-3′. The promoter region of
RAP2 from −2000 to +200 was amplified from the genomic DNA of the PANC-1 cells and ligated into Promega’s pGL3-Basic vector (Promega, Madison, USA) to generate the pGL3-RAP2 construct. The mutated
RAP2 promoter luciferase construct was generated by using TOYOBO’s KOD-Plus Mutagenesis Kit (Toyobo, Osaka, Japan).

All shRNAs were obtained from Sigma-Aldrich, except for the scramble shRNA, which was acquired from Addgene as a gift from D. Sabatini (Addgene, 1864). The knockdown efficiencies of the shRNAs were validated by Sigma-Aldrich using quantitative PCR. The clone identities of the shRNA vectors and their knockdown efficiencies are provided in Supplementary Table 3. Antibodies and their dilutions used in this study are listed in Supplementary Table 4.

CD44⁺CD24⁻ CSCs were transfected with either pMKO.1 puro hTERT shRNA (Addgene, plasmid 10688) or pBabe-puro hTERT (Addgene, plasmid 1771) to knockdown or overexpress hTERT, respectively, in CD44⁺CD24^- CSCs. Cells transfected with a scramble shRNA (Addgene, plasmid 1864) served as control. In brief, each plasmid was co-transfected with packaging plasmids pCMV-VSV-G (Addgene, plasmid 8454) and pCL-Eco (Addgene, plasmid 12371) into virus packaging cell line HEK 293T (ATCC) using FuGENE HD Transfection Reagent (Promega, Lyon, France) following the standard procedure. The culture medium was changed after 24 h with fresh DMEM medium supplemented with 10% FBS. The conditioned medium containing viruses was collected in the following two consecutive days and polybrene (8 μg/ml) was added into the virus-containing medium. Then the culture media of the candidate CD44⁺CD24⁻ CSCs were replaced with the lentivirus-containing media. After 24 h, the virus-infected cells were selected with puromycin (1 μg/ml) and cultured in the presence of puromycin for 3 weeks to generate clones of stable cell lines of hTERT^high and hTERT^-/low CD44⁺CD24⁻ CSCs. These cells were collected and used for subsequent experiments.

To generate shYAP expressing stable PK9 and PANC1 cells, The pLKO.1-based lentiviral plasmid containing YAP shRNA (NM006106) expression cassettes were purchased from Sigma-Aldrich. Scramble shRNA (Addgene plasmid 1864) was used as a control. Vectors were produced in HEK293T cells by co-transfection of the different transfer vectors with the packaging plasmid pCMV-deltaR8.91 and the VSV envelope-coding plasmid pMD2.G. After transfection (48h), lentiviral supernatant was filtered through a 0.45 μm syringe filter and used to infect YAP into PK9 and PANC1 cells by spinning them down with vector containing supernatants for 90 min at 1500xg at room temperature and leaving them incubate overnight at 37°C, then the fresh medium were replaced the transduction supernatant. Cells were then further incubated for 72H before collection for WB. Stable silent cells were selected using 3 μg/ml puromycin (Sigma) in the culture medium.

The RNAi consortium clone IDs for the shRNAs used in this study are as follows: shARG2-A06 TRCN0000051018 (CGAACATTTGATCTGCTGATT); shARG2-A07 TRCN0000051019 (CCTATCGAGAAGGCATGTATA); shARG2-A10 TRCN0000051022 (GTTCACCAGATGAATCAGAAA); shARG2-B09 TRCN0000369866 (GAACTATGATATCCAGTATTT); shARG2-B10 TRCN0000333446 (CCCTTACCACTTCATCAGGAA); shGFP TRCN0000072182 (TCTCGGCATGGACGAGCTGTA). Scramble shRNA (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was from Addgene (Plasmid # 1864). For generation of PDA cells with stable ARG2 or control (Scramble or GFP) knockdown, lentiviral supernatants produced from pLKO plasmids encoding the corresponding hairpins were used, and infected cells were selected for at least 7 days with 4 μg ml⁻¹ puromycin (Sigma-Aldrich, P8833).

Bovine Creb5 shRNAs targeting the Creb5 3′UTR were designed using Block-iT RNAi designer (Thermo Fisher). The most efficient Creb5 shRNA sequence we identified was: CCG GGC CTT CAA GAA GAG CTG TTG CCT CGA GGC AAC AGC TCT TCT TGA AGG CTT TTT G (targeting sequence is underlined; employed in Fig. 3a–c). Oligos (ordered from Integrated DNA Technologies) were annealed in a 10 μl reaction (1 μl Forward oligo (100 μM), 1 μl Reverse oligo (100 μM), 1 μl T4 ligation buffer (10X), 6.5 μl nuclease-free H₂O, 0.5 μl T4 polynucleotide kinase (NEB)) in a PCR machine, programmed to cycle: 37 °C 30 min, 95 °C 5 min, and then ramp down to 25 °C at 5 °C/min. Annealed Oligos that are compatible with the sticky ends of EcoRI and AgeI were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI, and gel purified. Lentiviral vector encoding shRNA targeting bovine Creb5 (shCreb5) was verified by sequencing (Genewiz). Lentiviral control vector containing a scrambled shRNA (shSCR) was ordered from Addgene (scramble shRNA, Addgene # 1864).

Plasmids mRFP-GFP-LC3 (catalog no. 21074) (28 (link)), HA-α-synuclein (catalog no. 40824), and GFP-α-synuclein A53T (catalog no. 40823) (59 (link)) were obtained from Addgene. HA-tagged HTT-72Q (60 (link)), GFP-HTT-21Q, and GFP-HTT-72Q (61 (link)) were described previously. To obtain mCherry-HTT-72Q and mCherry-α synuclein, mCherry cDNA was cloned into pcDNA3 flanked with HindIII/BamHI sites. To ligate HTT-72Q into pcDNA mCherry, HTT-72Q was cut with BglII/EcoRI, and pcDNA mCherry was cut with BamHI/EcoRI. To ligate α-synuclein A53T into pcDNA mCherry, α-synuclein was cut with BamHI/XhoI, and pcDNA3 mCherry was cut with BglII/SalI. Plasmids were confirmed by DNA sequencing. Scramble shRNA (Addgene, 1864) and mTOR shRNA (Addgene, 1855) was a gift from Dr. David Sabatini (62 (link)). STX-17 shRNA was purchased from Sigma (TRCN0000379933).