TWIST1 shRNA, 5’-CCTGAGCAACAGCGAGGAAGA-3’ in the pLKO vector (Sigma) was used. Two previously validated oligos for DDR2 shRNA and shSCRM control sequence were used51 (link). The oligos for human DDR2 shRNA, 5’- GCCAGATTTGTCCGGTTCATT-3’ and 5’-GCCAAGTGATTCTAGCATGTT-3’, and scramble control, 5’- CCTAAGGTTAAGTCGCCCTCGCTC-3’, were cloned into the pLKO vector and infected cells were selected in puromycin (Sigma). For all hairpins, polyclonal populations were tested for decreased DDR2 expression levels by western blot analysis.
Plko vector
Manufactured by Merck Group
Sourced in United States
The PLKO vector is a plasmid-based expression vector commonly used for gene delivery and protein expression in mammalian cell lines. It contains a promoter and selection marker to facilitate the selection and cultivation of transfected cells. The core function of the PLKO vector is to serve as a tool for the introduction and expression of genetic material in various experimental and research applications.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Corning (2 mentions)
Transit lt1, by Mirus Bio (2 mentions)
Plenti cmv blasticidin vector, by Addgene (2 mentions)
Sh1 trcn0000318424, by Merck Group (2 mentions)
Sh2 trcn0000318425, by Merck Group (2 mentions)
Psuper retro puro vector, by Oligoengine (2 mentions)
Puromycin, by Merck Group (2 mentions)
Pvsv g, by Thermo Fisher Scientific (2 mentions)
Midiprep kit, by Qiagen (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Lentiviral shrna clones, by Merck Group (1 mentions)
Non targeting shrna control, by Merck Group (1 mentions)
Birc3, by Merck Group (1 mentions)
Polybrene, by Merck Group (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
Celltiter 96 aqueous kit, by Promega (1 mentions)
Quickchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Shc002, by Merck Group (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
19 protocols using plko vector
1
DDR2 Knockdown in Cell Lines
2
DDR2 Knockdown in Cell Lines
3
Lentiviral Transduction of HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T packaging cells (5.5 × 105 cells) were seeded in 6-well plates in antibiotic-free media and incubated for 24 h. The cells were transfected with a mixture of 500 ng packaging plasmid (pCMV-R8.74psPAX2), 50 ng of envelope plasmid (pCMV-VSV-G), and 500 ng of pLKO vector containing the hairpin sequence (Sigma; Supplementary Table 7 ) using TransIT-LT1 (Mirus Bio) following the manufacturer’s protocol. shControl plasmids were obtained from Prof. Andrew Grimson (Cornell University). Eighteen hours post transfection, media were replaced with media containing 20% FBS and incubated for a further 24 h. Media containing virus particles were harvested, centrifuged (800 × g, 10 min), filtered through 0.45 μm filter, and used for infection or frozen at –80 °C for later use.
HEK293T cells (5.5 × 106 cells) in 6-well plates were treated with 1 mL of virus-containing media in a total volume of 6 mL of media containing 8 μg/mL polybrene. After 24 h, media were changed and the cells were incubated for 24 h. Following this period, media were changed to media containing 2 μg/mL puromycin (Corning) and allowed to grow to confluence. Following selection, cells were assayed by western blotting.
HEK293T cells (5.5 × 106 cells) in 6-well plates were treated with 1 mL of virus-containing media in a total volume of 6 mL of media containing 8 μg/mL polybrene. After 24 h, media were changed and the cells were incubated for 24 h. Following this period, media were changed to media containing 2 μg/mL puromycin (Corning) and allowed to grow to confluence. Following selection, cells were assayed by western blotting.
4
Overexpression and knockdown of Gm5524 and Gm15645 in mouse podocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse Gm5524 and Gm15645 cDNA sequences were synthesized and subsequently inserted into the pCDNA3.1 vector (Invitrogen; Thermo Fisher Scientific, Inc.), and the empty pCDNA3.1 vector was used as a control. Gm5524 and Gm15645 short hairpin (sh)RNA oligos were synthesized, annealed and inserted into the pLKO vector (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). All the vectors were prepared using Midiprep kits (Qiagen GmbH, Hilden, Germany), and 2 µg plasmid were transfected into mouse podocytes with ~70% density in six-well plates using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Gm5524, Gm15645 overexpression vectors and the shRNA lentivirus were purchased from Genscript (Nanjing, China). A total of 48 h following transfection, the cells were selected using puromycin for 48 h and harvested for further RT-qPCR or western blot analysis. The sequence of scrambled (Scr) shRNA (Sigma-Aldrich; Merck KGaA; 50 ng/µl) is 5′-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3′.
5
Knockdown and Overexpression of Fascin and INF2-CAAX
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The knockdowns of Fascin and INF2-CAAX were achieved using pSUPER.Retro.puro vector (Oligoengine) encoding shRNA targeting mouse/human Fascin (Sun et al., 2011 (link), 2013 (link)), human Cortactin, and human INF2-CAAX (Korobova et al., 2013 (link)). To rescue Fascin knockdown or overexpress Fascin proteins, wild-type or mutant Fascin (S39E and 149-151A mutants) (Yang et al., 2013 (link)) cDNAs were subcloned into pLenti.CMV.blasticidin vector (Addgene_17486) (Campeau et al., 2009 (link)). pLKO vector encoding shRNAs for DRP1 were purchased from Sigma (sh1 TRCN0000318424; sh2 TRCN0000318425). The retroviral and lentiviral particles were packaged in HEK293 cells using the PEI transfection method, and concentrated as previously described (Yang et al., 2012 (link)).
6
Cloning and Knockdown of ZNF804A and RPSA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human full-length ZNF804A cDNA (reference sequence: NM_194250.1) was PCR amplified from mRNA of SH-SY5Y human neuroblastoma cells and subcloned into the lentiviral vector pLV-3FLAG3HA-T2A-GFP at Nhe-I and BamH-I sites. Mouse Zfp804a cDNA (reference sequence: NM_175513.3) was PCR amplified from mRNA of mouse brain and subcloned into pcDNA3 vector with 3FLAG tag using primers: 5′-ATGGAGTGTTACTACATTGTCATCAGC-3′ and 5′-CTAGAAGAGGGGCTGGAGGGGAATGA-3′. The sequences for shRNAs targeting mouse Zfp804a are as follows: control shRNA: 5′-GGCTCCCGTGAATTGGAATCC-3′ against firefly luciferase; shRNA-1: 5′-CAGAGAGAATTTGCTCGAAATG-3′ shRNA-2: 5′-TCCTTTGCATTTCCAAAGAAAG-3′ in pLB2-CPGm vector. The sequences for shRNAs targeting mouse Rpsa are as follows: shRNA-3: 5′-GTGACGGTATCTACATCATAAA-3′ shRNA-4: 5′-GCCTGATCTTTACTTCTACAGA-3′, in pLKO vector (Sigma, St. Louis, MO, USA). Human siRNAs used in paper are as follows: siControl: 5′-rCrUrUrCrCrUrCrUrCrUrUrUrCrUrCrUrCrCrCrUrUrGrUGA, siRNA-1: 5′-rGrCrArGrArUrCrArArArUrArCrCrArCrUrA, siRNA-2: 5′-rGrGrU rUrUrA rUrArCrArArCrUrArCrGrArA. Other constructs expressing interacting proteins were obtained from the DNASU Plasmid Consortium.
7
Knockdown and Overexpression of TFB1M
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All short hairpin RNAs (shRNAs) (except sh3′ UTR) against TFB1M were purchased commercially in the pLKO vector (Sigma-Aldrich). The shRNA targeting the TFB1M 3′ UTR was designed and subcloned into the pLKO vector. Genes encoding TFB1M and TFB1M mutants were subcloned into the pSin-3 × Flag vector. PLC cells were infected with lentivirus followed by antibiotic selection to establish stable cell lines.
8
Lentiviral Transduction of BMDMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T packaging cells (1.25 × 106 cells) were seeded in T75 flasks in antibiotic-free media and incubated for 24 h. The cells were transfected with a mixture of 2500 ng packaging plasmid (pCMV-R8.74psPAX2), 250 ng of envelope plasmid (pCMV-VSV-G), and 2500 ng of pLKO vector containing the hairpin sequence (Sigma; Supplementary Table 7 ) using TransIT-LT1 (Mirus Bio) following the manufacturer’s protocol. shControl plasmids were obtained from (Sigma or Addgene; Supplementary Table 7 ). Eighteen hours post transfection, media were replaced with media containing 30% FBS and incubated for a further 24 h. Media containing virus particles were harvested, filtered through 0.45 μm filter, and used for infection.
BMDMs (2.2 × 107 cells) in T75 plates were treated with 4 mL of virus-containing media in a total volume of 24 mL of media containing 4 μg/mL polybrene. After 24 h, media were changed and the cells were incubated for 24 h. Following this period, media were changed to media containing 2.5 μg/mL puromycin (Corning) and allowed to grow to confluence. Following selection, cells were assayed by western blotting.
BMDMs (2.2 × 107 cells) in T75 plates were treated with 4 mL of virus-containing media in a total volume of 24 mL of media containing 4 μg/mL polybrene. After 24 h, media were changed and the cells were incubated for 24 h. Following this period, media were changed to media containing 2.5 μg/mL puromycin (Corning) and allowed to grow to confluence. Following selection, cells were assayed by western blotting.
9
Genetic Manipulation of NF1, MEK, RAS, and HIF1α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NF1-GRD sequence was introduced in Nf1−/− MEFs using the pMSCV-GRD vector [25 (link)]. pBABE vectors were used for expression of constitutively active (CA: S217E/S221E) and dominant negative (DN: S217A) MEK1 and hyperactive RAS (G12D mutant) (Addgene, #58902). For SIRT3, SIRT4 and SIRT5 overexpression, pcDNA3.1-SIRT3/SIRT4/SIRT5 (Addgene, #13814/13815/13816) were used for sub-cloning sirtuin genes into a pBABE vector. pWPI vector was used for NDI1 expression [30 (link)] and pFUGW was used for overexpression of GFP (as a control), SIRT3 and SOD2 [31 (link)]. Murine HIF1α was silenced using the pLKO vector (Sigma) harboring shRNA against two different target sequences (#20: CCCATTCCTCATCCGTCAAAT; #22: TGGATAGCGATATGGTCAATG). HIF1α overexpression was achieved using the pBABE vector harboring either the human wild-type (Addgene, #19365) or the mutated P402A/P564A protein (Addgene, #19005). Retroviral or lentiviral vectors were used for the production of viral particles and infected cells were then selected with 2 µg/ml puromycin.
10
Knockdown and Overexpression of Fascin and INF2-CAAX
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!