Dsirna 1

Knock-down of STAT2 was performed as previously described (15 (link)). Dicer-substrate interference RNAs (DsiRNAs) targeting BISPR and negative control DsiRNAs were purchased from Integrated DNA Technologies (DsiRNA#1 sense: GACACACAGAGUAUCCUUAACCCAC, antisense: GUGGGUUAAGGAUACUCUGUGUGUCUU, which target nucleotides 670–694 of BISPR close to the 5′ end of the last exon; DsiRNA#2 sense: CACUUAGGCAGGAGGAUCACUCGAG, antisense: CUCGAGUGAUCCUCCUGCCUAAGUGUU, which target nucleotides 546–570 of BISPR close to the 3′ end of the third exon). THP1 cells were seeded onto six-well plates and transfected with 20 nM final concentration of DsiRNAs using Lipofectamine ^® RNAiMax Reagent (Invitrogen) according to the manufacturer’s protocol. The transfected cells were incubated for 24 h in RPMI 1640 supplemented with 10% FBS and used for the downstream experiments. EZH2 knock down studies were performed on THP1 cells using shRNA constructs TRCN0000040074 and TRCN0000040077 targeting EZH2 and the non-targeting SHC002 shRNA construct from Sigma. Lentiviral preparation, cell transfection, and RNA harvest was performed as described (15 (link)).

Dicer-substrate short interfering RNA (DsiRNA) oligos targeting the S. mansoni AMPK α sequence (GenBank accession number MH445971) at three different sequence positions, 26 nucleotides in length, were prepared by Integrated DNA Technologies (IDT): DsiRNA #1- CD.Ri.195363.13.5 (forward 5′- rGrUrCrArArArGrUrUrGrGrArArUrUrCrArCrArArArUrCTA -3′ and reverse 3′-rUrArGrArUrUrUrGrUrGrArArUrUrCrCrAr ArCrUrUrUrGrArCrUrU-5′) targeting nucleotide positions 120–145, DsiRNA #2- CD.Ri.195363.13.4 (forward 5′-rCrArCr UrGrGrArUrCrUrGrCrUrArGrUrCrCrArArCrCrAAT-3′ and reverse 3′-rArUrUrGrGrUrUrGrGrArCrUrArGrCrArGrArUrC rCrArGrUrGrCrU-5′) targeting nucleotide positions 1805–1830, DsiRNA #3- CD.Ri.195363.13.2 (forward 5′-rArGrUrArUrUrUr ArArArGrCrArArUrGrArArUrUrCrArCTT-3′ and reverse 3′-r ArArGrUrGrArArUrUrCrArUrUrGrCrUrUrUrArArArUrArCr UrUrC-5′) targeting nucleotide positions 1,499–1,524. Scrambled Negative Control DsiRNAs were also supplied by IDT. DsiRNAs were reconstituted in Duplex Buffer (Integrated DNA Technologies) to a final concentration of 100 μM then heated at 95°C for 2–3 min and allowed to cool at room temperature for 1 h before use.