Total RNA was isolated from Vero E6 and Caco-2 cells 48 hours after infection using RNAdvance Viral Kit (Beckman) using a KingFisher and RNeasy Mini Kit (Qiagen), respectively. cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit or H Minus RT kit (Thermo Fisher). Two regions of the viral genome of SARS-COV-2 were amplified. The first set of primers N-FW (5’-TTACAAACATTGGCCGCAAA-3’), N-RV (5’-GCGCGACATTCCGAAGAA-3’) and the probe N-probe (5’-FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1-3’) amplified a region specific viral N RNA as a measure of total viral RNA and the second set of primers RdRP-FW: (5’-GTGARATGGTCATGTGTGGCGG-3’), RdRP-RV (5’- CARATGTTAAASACACTATTAGCATA-3’) and the probe RdRP-Probe (5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1-3’) amplified a fragment of the viral RNA-dependent RNA polymerase (RdRp) as a measure of genomic viral RNA. The fold change in viral RNA was normalized with the amplification of a fragment of human RNAse P using the primers RP-FW (5’-AGA TTTGGACCTGCGAGCG-3’), RP-RV (5’-GAG CGG CTG TCT CCA CAA GT-3’) and the probe RP-probe (5’-FAM-TTCTGACCTGAAGGCTCTGCGCG–BHQ-1-3’).
Rnadvance viral kit
Manufactured by Beckman Coulter
Sourced in United States
The RNAdvance Viral Kit is a nucleic acid extraction system designed to isolate and purify viral RNA from various sample types. It utilizes magnetic bead-based technology to efficiently capture and extract RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Sensifast probe lo rox one step kit, by Meridian Bioscience (4 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
H minus rt kit, by Thermo Fisher Scientific (2 mentions)
Biomek i7, by Beckman Coulter (2 mentions)
Biomek i7 automated workstation, by Beckman Coulter (2 mentions)
Nextera xt kit, by Illumina (1 mentions)
R9.4.1 flow cell, by Oxford Nanopore (1 mentions)
Novaseq instrument, by Illumina (1 mentions)
Sheep blood, by BD (1 mentions)
Rapid barcoding kit, by Oxford Nanopore (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Native barcoding kit, by Oxford Nanopore (1 mentions)
Gridion instrument, by Oxford Nanopore (1 mentions)
7 protocols using rnadvance viral kit
1
SARS-CoV-2 Viral RNA Quantification
2
Genome Sequencing of S. dysgalactiae subsp. equisimilis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomes of the S. dysgalactiae subsp. equisimilis strains were sequenced with methods described previously for S. pyogenes (17 (link), 38 (link), 54 (link), 61 (link), 62 (link)). Briefly, strains were grown at 37°C with 5% CO2 on tryptic soy agar with 5% sheep blood (Becton, Dickinson, Franklin Lakes, NJ) or in Todd-Hewitt broth with 2% (wt/vol) yeast extract (THY; Difco Laboratories, Franklin Lakes, NJ). Chromosomal DNA for Illumina short-read sequencing was isolated with the RNAdvance viral kit (Beckman Coulter, Brea, CA) and a BioMek i7 instrument (Beckman Coulter). Libraries were prepared with the NexteraXT kit (Illumina, San Diego, CA) and sequenced with a NovaSeq instrument (Illumina) using a 2 × 250-bp protocol. Chromosomal DNA for long-read sequencing was isolated with a DNeasy blood and tissue kit (Qiagen, Germantown, MD). Libraries were prepared with either a native barcoding kit or rapid barcoding kit (Oxford Nanopore Technologies, United Kingdom) and sequenced with a GridION instrument using version R10.4 or R9.4.1 flow cells (Oxford Nanopore Technologies), respectively.
3
SARS-CoV-2 Viral Load Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral load in lungs of SARS-CoV-2 infected mice was quantified by qRT-PCR and by plaque assay [4 (link)]. Lungs were ground in 1.5 mL of PBS and 200 µL was added to LBF lysis buffer. RNA was extracted using RNAdvance Viral Kit on a Biomek i7 automated workstation (Beckman Coulter, Indianapolis, IN, USA), according to the manufacturer’s protocol. Each sample was eluted in 50 µL of RNase-free water. RT-PCR was performed using the SensiFASTTM Probe Lo-ROX One-Step kit (Bioline, London, UK). Primers and probe sequences, targeting the SARS-CoV-2 E gene, were based on the Berlin protocol published in the WHO recommendation for the detection of SARS-CoV-2 and as described before [4 (link)]. The thermal cycling reaction was performed at 48 °C for 20 min for reverse transcription, followed by 95 °C for 2 min, and then 45 cycles of 15 s at 94 °C; 35 s at 60 °C for the E gene amplification. Cycle Threshold (Ct) values were converted to PFU equivalents (PFU Eqv.), according to a calibration curve determined in parallel.
4
SARS-CoV-2 Detection by Real-Time RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were vigorously vortexed, and from each elution 200 μL swab extraction were processed using RNAdvance Viral kit (Beckman Coulter) on the Biomek i7 Automated Workstation (Beckman Coulter), according to the manufacturer's protocol. Each sample was eluted in 50 μL of RNase-free water. Real-time RT-PCR assays, targeting the SARS-CoV-2 E gene, were performed using the SensiFAST Probe Lo-ROX One-Step kit (Bioline). The final concentration of primers was 600 nM and the probe concentration was 300 nM. Primers and probe for the E gene assay were taken from the Berlin protocol published in the WHO recommendation for the detection of SARS-CoV-2. Thermal cycling was performed at 48°C for 20 min for reverse transcription, followed by 95°C for 2 min, and then 45 cycles of 94°C for 15 s, 60°C for 35 s. Virus infectivity was tested by seeding quadruplets of 200 μL on VERO E6 cells for CPE assay as described above. The limit of detection of the CPE assay has been determined to be 10 pfu/mL.
5
SARS-CoV-2 Detection Using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All procedures for RNA extraction and RT real-time PCR analysis were done as described previously [15 ]. Briefly, 200 µl of each sample was transferred to 150 µl of lysis buffer, followed by incubation for 20 minutes at room temperature for virus denaturation and inactivation. RNA was extracted using an RNAdvance Viral Kit and a Biomek i7 Automated Workstation (Beckman Coulter) and eluted with 25-50 µl of water.
Primers and probes for the SARS-CoV-2 E and N genes were designed according to the Berlin protocol [16 ], and RT-PCR assays were performed according to WHO instructions, using a SensiFAST Probe Lo-ROX One-Step Kit (Bioline). The sensitivity of the RT real-time PCR was determined by performing a virus dilution assay, and the lowest virus concentration detected was 0.1 pfu/ml (Supplementary Fig. S1).
Primers and probes for the SARS-CoV-2 E and N genes were designed according to the Berlin protocol [16 ], and RT-PCR assays were performed according to WHO instructions, using a SensiFAST Probe Lo-ROX One-Step Kit (Bioline). The sensitivity of the RT real-time PCR was determined by performing a virus dilution assay, and the lowest virus concentration detected was 0.1 pfu/ml (Supplementary Fig. S1).
6
Quantifying SARS-CoV-2 Viral Load in Murine Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral load in lungs of SARS-CoV-2-infected mice (200 PFU) treated with the MD65 Ab was quantified by qRT-PCR and by plaque assay (see above). Lungs were grinded in 1.5 ml PBS and 200 µl were added to LBF lysis buffer. RNA was extracted using RNAdvance Viral Kit on a Biomek i7 automated workstation (Beckman Coulter, IN) according to the manufacturer’s protocol. Each sample was eluted in 50 µl of RNase-free water. RT-PCR was performed using the SensiFASTTM Probe Lo-ROX One-Step kit (Bioline, UK). Primers and probe sequences, targeting the SARS-CoV-2 E gene, were based on the Berlin protocol published in the WHO recommendation for the detection of SARS-CoV-2 [E_Sarbeco_F1 ACAGGTACGTTAATAGT TAATAGCGT, E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA, E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG]. The primers and probe were used at a final concentrations of 600 and 300 nM, respectively. The thermal cycling reaction was performed at 48 °C for 20 min for reverse transcription, followed by 95 °C for 2 min, and then 45 cycles of 15 s at 94 °C; 35 s at 60 °C for the E gene amplification. Cycle threshold (Ct) values were converted to PFU equivalents (PFU Eqv.), according to a calibration curve determined in parallel.
7
SARS-CoV-2 Viral RNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from Vero E6 and Caco-2 cells 48 hours after infection using RNAdvance Viral Kit (Beckman) using a KingFisher and RNeasy Mini Kit (Qiagen), respectively. cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit or H Minus RT kit (Thermo Fisher). Two regions of the viral genome of SARS-COV-2 were amplified. The first set of primers N-FW (5’-TTACAAACATTGGCCGCAAA-3’), N-RV (5’-GCGCGACATTCCGAAGAA-3’) and the probe N-probe (5’-FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1–3’) amplified a region specific viral N RNA as a measure of total viral RNA and the second set of primers RdRP-FW: (5’-GTGARATGGTCATGTGTGGCGG-3’), RdRP-RV (5’- CARATGTTAAASACACTATTAGCATA-3’) and the probe RdRP-Probe (5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1–3’) amplified a fragment of the viral RNA-dependent RNA polymerase (RdRp) as a measure of genomic viral RNA. The fold change in viral RNA was normalized with the amplification of a fragment of human RNAse P using the primers RP-FW (5’-AGA TTTGGACCTGCGAGCG-3’), RP-RV (5’-GAG CGG CTG TCT CCA CAA GT-3’) and the probe RP-probe (5’-FAM-TTCTGACCTGAAGGCTCTGCGCG–BHQ-1–3’).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!