The DNA was isolated from frozen blood samples with the illustra blood genomicPrep Mini Spin Kit (GE Healthcare, Waukesha, WI, USA). Polymerase chain reaction (PCR) primers based on the human GPx1 gene sequence flanking the 198 polymorphism (rs 1050450) (GPx1 forward primer, 50-TGCCCCTACGCAGGTACA-30; GPx1 reverse primer, 50-TCCCAAATGACAATGACACAG-30) were used to generate a 337-bp amplification product [24 (link)]. PCR was performed following a previously described method [27 (link)]. The analyses were performed in duplicate.
Genomicprep mini spin kit
Manufactured by GE Healthcare
Sourced in United Kingdom, United States
The GenomicPrep Mini Spin Kit is a lab equipment product designed for the rapid and efficient isolation of genomic DNA from various sample types. It utilizes a spin column-based method to extract high-quality DNA suitable for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Cxcl10, by GE Healthcare (2 mentions)
Platinum sybr green protocol, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Brilliant 3 ultra fast sybr green qpcr master mix, by Agilent Technologies (1 mentions)
Mx3000p qpcr system, by Agilent Technologies (1 mentions)
Alexa fluor 594 conjugated goat anti mouse antibody, by Thermo Fisher Scientific (1 mentions)
Mouse monoclonal anti flag, by Merck Group (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Steponeplus qpcr system, by Thermo Fisher Scientific (1 mentions)
Clc genomic workbench software, by Qiagen (1 mentions)
Nextera dna sample preparation kit, by Illumina (1 mentions)
Miseq system, by Illumina (1 mentions)
Middlebrook 7h9 liquid medium, by BD (1 mentions)
Oleic acid albumin dextrose catalase enrichment, by BD (1 mentions)
18 protocols using genomicprep mini spin kit
1
Genotyping of GPx1 Polymorphism
2
Genotyping ATOH7 rs7916697 Polymorphism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA samples were obtained from peripheral EDTA blood using the illustra blood genomicPrep Mini Spin kit (GE Healthcare, Buckinghamshire, UK) and genotyped for rs7916697 G>A polymorphism near ATOH7 gene (NG_031934.1) using the TaqMan® SNP Genotyping Assay (assay ID: C_27850155_10; Applied Biosystems Inc., Foster City, CA, USA) on ABI 7500 Real-Time PCR System (Applied Biosystems) using recommended cycling conditions as described previously [17 (link)]. Fluorescence was measured at annealing step and genotype calling was performed using the automated 2-color allele discrimination software on ABI 7500.
3
DNA Extraction from Blood Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from patients and controls was obtained from peripheral blood (7 mL) collected in EDTA tubes from all participating individuals. Extraction was performed using the illustra blood genomicPrep Mini Spin kit (GE Healthcare, Buckinghamshire, UK) and stored at –20 °C in aliquots until further use. Quantification of extracted DNA was performed using a NanoDrop ND-2000c spectrophotometer (Thermo Scientific, Wilmington, DE, USA).
4
Quantitative analysis of GFP gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) was used to measure the amount of gfp gene in different BRY strains. Genomic DNA was extracted using the illustra bacteria genomic Prep Mini Spin Kit (GE Healthcare). The DNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). gDNA was used as template in qRT-PCR using an Mx3000P qPCR system (Agilent) and Brilliant III Ultra-Fast SYBR Green QPCR master mix (Agilent). Oligonucleotides designed for detection of the gfp gene and the internal control, bglB, are listed in Table S2. Relative quantities of the gfp target gene were determined by normalizing reaction threshold cycle (CT) values to that of the bglB reference gene. ΔCT values for the BRY33 reactions were used as calibrators (ΔΔCT = ΔCT target – ΔCT BRY33) for analysis of results by the relative quantification method (2−ΔΔCT), which was used with standard curves (36 (link)). Quantities of the gfp target gene, relative to that at the tam locus, are represented as gene dosage. Each reaction was repeated at least three times for each of three separate biological replicates to yield mean and standard deviation for each experiment.
5
Bacterial DNA Extraction for Pure Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of genomic DNA from pure cultures (i.e., no contamination) was performed with the illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare, United Kingdom) following the manufacturer’s guidelines.
6
Conditional expression and localization of IncS
Check if the same lab product or an alternative is used in the 5 most similar protocols
Allelic exchange of the incS ORF with the aadA-gfp cassette was confirmed by PCR (S1 Fig and S1 Table ). WT and ΔincSCt pTet-IncSCt genomic DNA, prepared using illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare), according the manufacturer recommendations, were used as template in PCR reactions using two sets of primers surrounding the 3kb homology recombination site (incS 3kb Up Fw & incS 3kb Dwn Rv) or surrounding the incS ORF (incS Up Fw & incS Dwn Rv). The PCR products were run into 1% agarose gel, stained with ethidium bromide, and viewed using UV transillumination. The PCR products were extracted from the agarose gel using QIAquick Gel Extraction Kit (Qiagen) and sequenced via Sanger performed by Genscript.
The conditional expression and inclusion localization of IncS Ct was validated by immunofluorescence. HeLa cells seeded on glass coverslips were infected with Ct ΔincSCt pTet-IncSCt in the presence of 0.5ng/ml aTc (+aTc) or not (-aTc) for 24 h, fixed stained with mouse monoclonal anti-FLAG (1:1,000; Sigma) and secondary antibodies (Alexa Fluor 594-conjugated goat anti-mouse antibody (1:500; Molecular Probes) and processed for confocal microscopy.
+ Expand
7
Genomic DNA Extraction from C. burnetii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNAs of 37 paraformaldehyde-fixed or heat-killed C. burnetii isolates were prepared according to the manufacturer´s protocol with the illustra bacteria genomic Prep Mini Spin Kit (GE Health Care), with 3 × 10 min incubation at 55 °C in the beginning and a final elution with 30 µl H2O as described in Bisle et al., 2016.
8
Pulmonary Inflammation and Parasite Load Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from lungs of control and infected mice with Trizol reagent (Invitrogen), transcribed to cDNA, and primers for CCL2 (F 5-TGGCTCAGCCAGATGCAGT-3, R 5-TTGGGATCATCTTGCTGGTG-3), CCL4 (F 5-TCTTGCTCGTGGCTGCCT-3, R 5-GGGAGGGTCAGAGCCCA-3), CCL5 (F 5-CAAGTGCTCCAATCTTGCAGTC-3, R 5-TTCTCTGGGTTGGCACACAC), CCL17 (F 5-CAGGGATGCCATCGTGTTTC-3, R 5-CACCAATCTGATGGCCTTCTT-3), CCL22 (F 5-TACATCCGTCACCCTCTGCC-3, R 5-CGGTTATCAAAACAACGCCAG-3), CXCL9 (F 5-AATGCACGATGCTCCTGCA-3, R 5-GGTCTTTGAGGGATTTGTAGTG-3) and CXCL10 (F 5-GCCGTCATTTTCTGCCTCA-3, R 5-CGTCCTTGCGAGAGGGATC-3) (Integrated DNA Technologies) used to quantify gene expression by PCR.
DNA from lungs of PbN-infected mice was extracted by illustra tissue & cells genomicPrep Mini spin kit (GE Healthcare). The primers of mouse endogenous gene, GAPDH (Forward: GGCAAATTCAACGGCACAGT and Reverse: AGATGGTGATGGGCTTCCC) and the Plasmodium berghei 18 s ribosomal 18 s gene (Forward: AAGCATTAAATAAAGCGAATACATCCTTA and 18 s Reverse: GGAGATTGGTTTTGACGTTTATGT) were used to determine the parasite load in the lungs by relative quantification, normalized with the mouse GAPDH (∆CT). The quantitative PCRs were carried out with the Platinum SYBR Green protocol (Invitrogen) on an Applied Biosystems 7500 real-time PCR system.
DNA from lungs of PbN-infected mice was extracted by illustra tissue & cells genomicPrep Mini spin kit (GE Healthcare). The primers of mouse endogenous gene, GAPDH (Forward: GGCAAATTCAACGGCACAGT and Reverse: AGATGGTGATGGGCTTCCC) and the Plasmodium berghei 18 s ribosomal 18 s gene (Forward: AAGCATTAAATAAAGCGAATACATCCTTA and 18 s Reverse: GGAGATTGGTTTTGACGTTTATGT) were used to determine the parasite load in the lungs by relative quantification, normalized with the mouse GAPDH (∆CT). The quantitative PCRs were carried out with the Platinum SYBR Green protocol (Invitrogen) on an Applied Biosystems 7500 real-time PCR system.
9
Bradyrhizobium DNA Extraction and Phylogenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from the cells of Bradyrhizobium strains in the Japanese culture collection30 (link) by using an illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare UK, Ltd.). nopP with its flanking regions was amplified by PCR with the oligonucleotide primers nopP_F1 and nopP_R1. Purified PCR products were subjected to Sanger sequencing with the primers nopP_F1, nopP_R1, nopP_F2, and nopP_R3. The obtained sequences were assembled and amino acid sequences were deduced in Genetyx-MAC v. 18.0.3 software (Genetyx Co., Tokyo, Japan). The ITS sequences between the 16S and 23S rRNA genes for phylogenetic analysis are listed in Supplementary Table 2 . The sequences were aligned using the CLUSTALW program62 (link). Neighbor-joining trees were constructed in MEGA v. 7 software63 (link) and 1000 bootstrap replicates were used to generate a consensus tree.
10
Cloning and Purification of N. maritimus Enzyme
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA of N. maritimus was extracted using an illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare). The gene encoding (S)-3-hydroxybutyryl-CoA dehydrogenase (Nmar_1028) was amplified by Q5 High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) from genomic DNA of N. maritimus using the forward primer (5′-GCG GCC ATA TCG AAG GTC GTC ATA TGG CAG TAA AAA ATA TCA CAA TTT TAG-3′) introducing an NdeI restriction site (italicized) at the initiation codon and the reverse primer (5′- TCT CAT GTT TGA CAG CTT ATC ATC GAT AAG CTT GAT TCA CTG CAT TGA TGT GAG-3′) introducing a HindIII site (italicized) after the stop codon. Touchdown PCR was used as follows: initial denaturation 3 min at 98°C, 20 cycles of 30-s denaturation at 98°C, 30-s primer annealing at 57°C (gradually reduced 0.2°C per cycle) and 40-s elongation at 72°C, followed by 15 cycles of 30-s denaturation at 98°C, 30-s primer annealing at 53°C and 40-s elongation at 72°C. The PCR product was treated with the corresponding restriction enzymes and then the gene was ligated into pET16b using T4 DNA ligase (NEB). The cloning of a gene into this vector with NdeI and HindIII restrictases adds an N-terminal His10-tag to the produced protein. The obtained plasmid was transformed into E. coli TOP10 for amplification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!