Iscript cdna supermix

Total RNA was extracted from 2.5 × 10⁵ cells with Total RNA Purification Kit (Norgen, Cat#37500), with modified elution volume of 27µL. RNA concentration was determined using NanoDrop 2000 Spectrophotometer and 1000µg of RNA was used to synthesize complementary DNA (cDNA) using iScript cDNA SuperMix (Bio-Rad, Cat#1708841) and a C1000 Thermo Cycler (Bio-Rad) according to the manufacturer’s guidelines. RT-qPCR analysis was performed with PerfeCTa SybrGreen (Quanta Biosciences, Cat#95054-100) and CFX96 instrument (Bio-Rad). Quantification of gene expression was performed by using CFX manager 3.0 software, with GAPDH as housekeeping gene. The following qPCR primers were used to measure mRNA levels of ITGA5 (FWD 5’-ACCTCTGATGCCTGAGTCCT-3’, REV 5’-AGAAGTACCCAGACCCCTCC-3’ and GAPDH (FWD 5’-TGAACCACCAACTGCTTAGC − 3’, REV 5’-GGCATGGACTGTGGTCATGAG-3’).

Isolated miRNA (2 μg each) were reverse-transcribed (RT) with the miScript II RT kit (Qiagen, Germantown, MD), according to the manufacturer’s instructions. After reverse transcription, cDNA samples were diluted 5× with TE buffer. Real-time RT-PCR was performed using the miScript SYBR green PCR kit (Qiagen). The following PCR primers were used for the detection of miRNA: miR-1207 (MIMAT0005871), miR-3198 (MIMAT0015083), and RNU6B. Fold change of miR-3198 expression relative to the control was calculated by the Δ-Δ Ct method with RNU6B as a reference gene. Isolated RNA (500 ng) was reverse-transcribed using the iScript cDNA-Supermix (Bio-Rad, Hercules, CA, USA), according to the manufacturer’s instruction. After reverse transcription, cDNA samples were diluted 5× with TE buffer. Real-time RT-PCR was performed using the SsoFast EvaGreen-Supermix (Bio-Rad). PCR primers used for the experiments were human OPG (forward, 5′-AAGGGCGCTACCTTGAGATAG-3′; reverse, 5′-GCAAACTGTATTTCGCTCTGGG-3′), human RANKL (forward, 5′-CGTTGGATCACAGCACATCAG-3′; reverse, 5′-GCTCCTCTTGGCCAGATCTAAC-3′), and human ribosomal protein S18 (RPS18) (forward, 5′-GATGGGCGGCGGAAAATAG-3′; reverse, 5′-GCGTGGATTCTGCATAATGGT-3′). Fold changes of OPG and RANKL expression relative to the control were calculated by the Δ-Δ Ct method with RPS18 as a reference gene.

RNA was extracted from RAW 264.7 cells using the GenElute mammalian total RNA Miniprep kit (Sigma‐Aldrich) with an on‐column genomic DNA digestion. For antioxidant gene expression analysis, RNA was extracted 1 day after the treatment of cells with 10 μM of DMF treatment, and the gene expression of Nqo1, Ho‐1 and Gcs was analysed.
For osteoclast marker gene expression analysis, RNA was extracted at 4 days after 100 ng/ml of RANKL stimulation of RAW 264.7 cells, and the gene expressions of Atp6v0d2, Cathepsin K (Ctsk), matrix metalloproteinase 9 (Mmp9) and tartrate‐resistant acid phosphatase (Trap) were analysed.
Isolated RNA (500 ng each) was reverse transcribed with iScript cDNA‐Supermix (Bio‐Rad, Hercules, CA, USA). Real‐time RT‐PCR was performed with SsoFast EvaGreen‐Supermix (Bio‐Rad). PCR primers used in the experiments were from PrimerBank (Boston, MA, USA) and have been described previously 10. Fold changes of genes of interest were calculated using the Δ‐Δ Ct method with ribosomal protein S18 (RPS18) was used as a reference gene.

RNA was extracted from the cultured cells using the GenElute Mammalian Total RNA Miniprep Kit (Sigma). On-column DNase treatment was performed to digest genomic DNA during RNA extraction. Isolated RNA (100 ng each) was reverse transcribed with iScript cDNA Supermix (Bio-Rad). Real-time RT-PCR was performed with SsoFast EvaGreen Supermix (Bio-Rad) using a CFX96 instrument (Bio-Rad). The PCR primers used in the experiments were from PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html). We used ribosomal protein S18 (RPS18) as the reference gene. The PrimerBank ID and sequences are as follows: IFN-γ (NM_008337.3):33468859a1, Up:ATGAACGCTACACACTGCATC; Dn:CCATCCTTTTGCCAGTTCCTC and RPS18 (NM_011296):6755368a1, Up:AGTTCCAGCACATTTTGCGAG; Dn:TCATCCTCCGTGAGTTCTCCA.

For antioxidant gene expression analysis, RNA was extracted two days after the treatment of cells with EGCG-GL or gelatin solution, and the expression of Nrf2, heme oxygenase 1 (Hmox1), and glutamate-cysteine ligase (Gclc) were analyzed. RNA was extracted from RAW 264.7 cells using the GenElute mammalian total RNA Miniprep-kit (Sigma-Aldrich, St. Louis, MO, USA) with an on-column genomic DNA digestion. Isolated RNA (500 ng each) was reverse-transcribed with an iScript cDNA-Supermix (Bio-Rad, Hercules, CA, USA). Real-time RT-PCR was performed with SsoFast™ EvaGreen^® Supermix EvaGreen-Supermix (Bio-Rad). PCR primers were from PrimerBank (Boston, MA, USA) and have been described previously [21 (link),23 (link),24 (link)]. Fold changes of gene expression were calculated by using the −∆∆Ct method with ribosomal protein S18 (RPS18) as the reference gene.

Total RNA was extracted from 2.5 × 10⁵ cells with Total RNA Purification Kit (Norgen, Cat#37500), with modified elution volume of 27µL. RNA concentration was determined using NanoDrop 2000 Spectrophotometer and 1000µg of RNA was used to synthesize complementary DNA (cDNA) using iScript cDNA SuperMix (Bio-Rad, Cat#1708841) and a C1000 Thermo Cycler (Bio-Rad) according to the manufacturer’s guidelines. RT-qPCR analysis was performed with PerfeCTa SybrGreen (Quanta Biosciences, Cat#95054-100) and CFX96 instrument (Bio-Rad). Quantification of gene expression was performed by using CFX manager 3.0 software, with GAPDH as housekeeping gene. The following qPCR primers were used to measure mRNA levels of ITGA5 (FWD 5’-ACCTCTGATGCCTGAGTCCT-3’, REV 5’-AGAAGTACCCAGACCCCTCC-3’ and GAPDH (FWD 5’-TGAACCACCAACTGCTTAGC − 3’, REV 5’-GGCATGGACTGTGGTCATGAG-3’).