Cold fusion

DNA for transfection was prepared as previously described [63 (link), 64 (link)]. A CRISPR sgRNA (TTATCTTTGCAGATATGGTC) targeting the 5’ end of the TRPS1 coding sequences was designed using Benchling. The sgRNA was cloned into hSpCas9 plasmid PX458 (Addgene #48138) as previously described [65 (link)], using the following primers:
A plasmid harboring a synthetic HygR-P2A-2xHA-FKBP_F36V insert was generated with Cold Fusion (System Biosciences), starting with the HygR-P2A-AID cassete in pMGS58 (Addgene #135311) [64 (link)] and the Puro-P2A-2xHA-FKBP_F36V casette in (Addgene #91793) [32 (link)]. The linear donor was generated by PCR using primers (IDT) that contain 50-nucleotide homology tails and gel-purified. The primers contained 5’ phosphorothioate modifications to increase PCR product stability in the cell [66 (link)]. The primers used for making PCR donor fragments were:

To generate a plasmid with the target sites, oligonucleotides containing the target sites (Additional file 3: Table S2) were annealed to form a DNA fragment that was cloned into a BglII digested pEVO backbone via Cold Fusion (System Biosciences). SgRNA (Additional file 4: Table S3) scaffold fragments were synthesized (Twist Bioscience) and cloned into pEVO plasmid containing the target sites utilizing NsiI and NotI restriction enzymes. The pEVO plasmid containing the target sites and the sgRNA scaffold was then used as a template in a PCR reaction where three different sgRNA spacers were included in the reverse primers. In that way, generated sgRNA fragments were then introduced to the pEVO vector in a stepwise manner, by cloning sgRNA1 with NotI and NsiI, sgRNA2 with NsiI, and sgRNA3 via XhoI and SalI. Un1Cas12f1 fragments were produced by Twist Bioscience and amplified via PCR and the TadA gene was prepared via PCR by using the pABE8e-protein plasmid as a template (Addgene plasmid # 161,788). To create Cas12f-ABE, both PCR products were used as a template for an overlap-PCR. The Cas12f-ABE was then cloned into the pEVO-TS-sg1-sg2-sg3 vector with BsrGI and XbaI restriction enzymes. The expression of the Cas12f-ABEs was controlled by the araBAD L-arabinose inducible promoter system.

Full-length wild-type and mutated CDS of mia40a a mia40b were amplified from mia40a^+/bns292 and mia40b^+/bns293 cDNA using specific primers (S3 Table). Amplicons were cloned into pCS2+ plasmids linearized with BamH1 using Cold Fusion (System Biosciences) and sequenced to confirm correct inserts. Plasmids were linearized with Not1 and mRNA was transcribed using the mMESSAGE mMACHINE SP6 synthesis kit (Ambion), followed by TURBO DNase treatment. mRNA was purified using the RNA Clean-Up and Concentrator kit (Zymo Research) and mRNA quality was assessed using the Nanodrop 2000c spectrophotometer (Thermo Fisher Scientific) and agarose gel electrophoresis. Different amount of wild-type versions, ranging from 50 to 500ng, were injected at 1-cell stage into embryos from a heterozygous in-cross of mia40a^+/bns292 larvae in the Tg(Xla.Eef1a1:mlsEGFP) transgenic background. The highest dose of mRNA that did not trigger a severe phenotype in larvae was chosen for the experiments. At 3 dpf, larvae were embedded in 1% low-melting agarose containing 0.04% Tricaine solution in a glass-bottom dish (MatTek Corporation, Ashland, MA, USA) and analysed using the LSM800 confocal laser scanning microscope (Zeiss).