We made use of the binary T-DNA vector pDE-Cas9, containing an Arabidopsis-codon-optimized Cas9 controlled by the constitutive Ubiquitin promoter (PcUBp) from Petroselinum crispum (Fauser et al., 2014 (link)) and the sgRNA subcloning vector pEN-C.1.1 containing the Arabidopsis U6-26 promoter for sgRNA expression, the sgRNA scaffold and BbsI-sites for subcloning of the protospacer sequence (Schiml et al., 2014 (link)). After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table S1 ) resulting in vector pFH89. We then digested pFH89 with MluI-HF (New England Biolabs) to extract the sgRNA cassette and ligated it into MluI-HF-digested pDE-Cas9, thereby creating the vector pFH99. We amplified the homology template from pFH95 using primers FH278/FH279 (Supplementary Table S1 ) and performed Gateway® BP-reaction with pDONR 207 (Invitrogen) resulting in vector pFH122. LR reaction (Invitrogen) of pFH99 with pFH122 led to the assembly of the IPGT repair vector pIPGT-Nuc.
Mlui hf
Manufactured by New England Biolabs
Sourced in United Kingdom
MluI-HF is a restriction endonuclease enzyme that recognizes and cleaves the DNA sequence 5'-ACGCGT-3'. It is a high-fidelity variant of the original MluI enzyme, providing more precise DNA cleavage with reduced star activity.
Automatically generated - may contain errors
Lab products found in correlation
Megascript t7 kit, by Thermo Fisher Scientific (2 mentions)
Nucleofector solution sf, by Lonza (2 mentions)
Amaxa 4d nucleofector x unit, by Lonza (2 mentions)
Envision plate reader, by PerkinElmer (2 mentions)
Passive lysis buffer (plb), by Promega (2 mentions)
Luciferase assay system, by Promega (2 mentions)
T4 dna ligase, by New England Biolabs (2 mentions)
Spei hf, by New England Biolabs (2 mentions)
Dig easy hybtm, by Roche (2 mentions)
Pcr dig labeling mix, by Roche (2 mentions)
Blocking reagent, by Merck Group (2 mentions)
Anti dig ap, by Merck Group (2 mentions)
Bcip nbt, by Merck Group (2 mentions)
Nbt bcip, by Roche (2 mentions)
Nanodrop one microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Plasmid plus maxi kit, by Qiagen (2 mentions)
Carbenicillin, by Merck Group (2 mentions)
Nhei hf, by New England Biolabs (1 mentions)
Kpni hf, by New England Biolabs (1 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions)
14 protocols using mlui hf
1
CRISPR-Cas9 system for genome editing
2
Targeted Gene Correction in Albino Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Tyr-repair of albino rats, a targeting ssAAV vector plasmid, pssAAV_rTyr-repair, was constructed. Tyr gene was amplified by PCR using the primers listed in Table S1 (Wistar Tyr amplification) using peripheral blood cells of Crlj:WI as a template. Tyr homology arms were amplified by PCR using the primers listed in Table S1 (5′-homology arm and 3′-homology arm) using the template as above. These homology arms include the Tyr_repair cassette, which has corrected sequences containing an in-frame silent mutation to provide an SnaBI site for RFLP analysis. Homology arms were inserted into pUC19 using an In-Fusion HD Cloning Kit. After confirmation of the sequence, homology arms and rTyr-repair cassette were excised using restriction endonucleases, NheI-HF and MluI-HF (New England Biolabs, Japan, Tokyo, Japan), and then ligated with pAAV_MCS2. AAV6_rTyr-repair was conducted as reported previously33 (link).
3
Generating Transgenic Arabidopsis Lines Expressing FgRALF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length FgRALF was PCR-amplified from cDNA extracted from F. graminearum-infected wheat cv. Bobwhite using Phusion High-Fidelity DNA polymerase (New England Biolabs). KpnI and MluI restriction sites were added to the 5′ and 3’ end of the FgRALF, respectively, using the primers listed in table S1 .
Digestion by KpnI-HF and MluI-HF (New England Biolabs) enabled entry of FgRALF into the vector pMS37, downstream of a 35S promoter and upstream of an ocs terminator, using standard restriction enzyme cloning techniques (Sandkvist et al., 1995 (link)). The 35S:FgRALF:ocs cassette was then sub-cloned into the binary plant vector pMLBART by NotI (New England Biolabs) digestion (Gleave, 1992 (link)). Sequence-verified constructs were transformed into the Agrobacterium strain GV3101 for transformation of the Arabidopsis ecotype Columbia-erecta using the floral-dip method (Clough and Bent, 1998 (link)).
For selection of transgenic lines, seeds were surface-sterilised and grown on Murashige and Skoog (MS) medium supplemented with kanamycin (50μg ml−1) and carbenicillin (100μg ml−1). Independent transgenic T1 lines that segregated 3:1 were carried through and homozygous T3 lines were selected for Fusarium pathogenicity assays.
Digestion by KpnI-HF and MluI-HF (New England Biolabs) enabled entry of FgRALF into the vector pMS37, downstream of a 35S promoter and upstream of an ocs terminator, using standard restriction enzyme cloning techniques (Sandkvist et al., 1995 (link)). The 35S:FgRALF:ocs cassette was then sub-cloned into the binary plant vector pMLBART by NotI (New England Biolabs) digestion (Gleave, 1992 (link)). Sequence-verified constructs were transformed into the Agrobacterium strain GV3101 for transformation of the Arabidopsis ecotype Columbia-erecta using the floral-dip method (Clough and Bent, 1998 (link)).
For selection of transgenic lines, seeds were surface-sterilised and grown on Murashige and Skoog (MS) medium supplemented with kanamycin (50μg ml−1) and carbenicillin (100μg ml−1). Independent transgenic T1 lines that segregated 3:1 were carried through and homozygous T3 lines were selected for Fusarium pathogenicity assays.
4
Replicon Plasmids and Electroporation
5
Generation of Infectious HCV Jc1 RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pFK-JFH1-J6 C-846_dg (briefly: Jc1) as previously described [28 (link)], kindly provided by Ralf Bartenschlager (Heidelberg, Germany), was used to generate full-length HCV Jc1 genomes(J6/JFH1 chimeric genotype 2a) by in vitro transcription.
The Jc1 plasmid was first digested with Mlu I-HF (NEB) for 2 hours (hrs) at 37 °C. Linearized DNA was purified by phenol/chloroform extraction and ethanol precipitation. Then, the concentration of dissolved DNA was measured by Qubit 2.0 Fluorimeter (ThermoFisher). The DNA size and linearization were checked on agarose gels.
In vitro transcription was performed using T7 RNA Polymerase (ThermoFisher) in the presence of 3.75 mM of each NTP, additional 5 mM MgCl2 and 10 mM DTT, and 30 ng/µL of linearized plasmid DNA. After 2 h of incubation at 37 °C, another 1 U/µL of T7 RNA Polymerase was added for 2 h more. Template DNA was then digested by 2 U RNase-free DNase I (NEB) per 1 µg of DNA for 1 h at 37 °C. HCV full-length Jc1 RNA transcripts were dissolved in equal amounts of RNase-free water. After removing the enzymes using GeneJET RNA Clean-up Kit (ThermoFisher), transcripts were checked for integrity by agarose gel electrophoresis and quantified by Qubit Fluorimeter.
The Jc1 plasmid was first digested with Mlu I-HF (NEB) for 2 hours (hrs) at 37 °C. Linearized DNA was purified by phenol/chloroform extraction and ethanol precipitation. Then, the concentration of dissolved DNA was measured by Qubit 2.0 Fluorimeter (ThermoFisher). The DNA size and linearization were checked on agarose gels.
In vitro transcription was performed using T7 RNA Polymerase (ThermoFisher) in the presence of 3.75 mM of each NTP, additional 5 mM MgCl2 and 10 mM DTT, and 30 ng/µL of linearized plasmid DNA. After 2 h of incubation at 37 °C, another 1 U/µL of T7 RNA Polymerase was added for 2 h more. Template DNA was then digested by 2 U RNase-free DNase I (NEB) per 1 µg of DNA for 1 h at 37 °C. HCV full-length Jc1 RNA transcripts were dissolved in equal amounts of RNase-free water. After removing the enzymes using GeneJET RNA Clean-up Kit (ThermoFisher), transcripts were checked for integrity by agarose gel electrophoresis and quantified by Qubit Fluorimeter.
6
In Vitro Transcription of Chimeric HCV Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
JFH1/J6 chimeric full-length HCV genome (JC1) [34 (link)] was generated by in vitro-transcription. Plasmids were first linearized with MluI-HF (NEB) and purified with phenol/chloroform extraction and precipitation by ethanol. Nucleic acid concentrations were measured using Qubit fluorimeter with corresponding assay kits. For transcription, 1 U/µL T7-RNA-Polymerase, 1 fold buffer, 3.75 mM of each rNTP, 10 mM DTT, 5 mM MgCl2 and 30 µg/mL DNA template was combined and incubated at 37 °C for 5 h. To remove the DNA template, 0.1 U/µL DNase I with corresponding buffer was added and incubated at 37 °C for 1 h. HCV-RNA was purified with “GeneJet RNA Cleanup and Concentration Micro Kit” (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. RNA integrity was confirmed by 0.8% agarose gel electrophoresis.
7
Generation of Complemented F. novicida Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U112 complemented strains were generated with the pEDL56 vector, a kind gift from Tom Kawula (Washington State University). Briefly, DNA was amplified by PCR with the Phusion PCR polymerase (Thermo Fisher) and gene-specific primers. PCR products and the pEDL56 vector were digested with the restriction enzymes MluI-HF and XmaI (New England BioLabs) and then ligated with T4 DNA ligase (New England BioLabs). Ligated plasmids were introduced into subcloning efficiency DH5α cells (ThermoFisher) by chemical transformation and grown on LB plates supplemented with 200 μg/ml hygromycin to select for transformants. Plasmids were purified with the QIAprep spin miniprep kit (Qiagen). Isolated plasmids were introduced by electroporation into electrocompetent F. novicida MFN245, a kind gift from Colin Manoil and Larry Gallagher (University of Washington), with a Gene Pulser II (Bio-Rad) at 1.5 kV, 400 Ω, and 25 μF. Transformants were selected by growth on MHA/c plates supplemented with 200 μg/ml hygromycin. Plasmids were then isolated from MFN245 as described previously and introduced into electrocompetent wild-type F. novicida U112 or selected transposon mutants.
8
Southern Blot Analysis of Cowpea Transgenics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of 10 µg from the cowpea lines of the cassettes AtRps5aproCre and AtUbq3prolox was digested overnight by SpeI-HF® and MluI-HF® (New England Biolabs), respectively. Restriction fragments were separated by gel electrophoresis and then transferred to GeneScreen Plus® hybridization transfer membrane (Cat# NEF1017001PK, PerkinElmer, Waltham, MA, USA). Hybridization was conducted using a digoxigenin (DIG)-labeled probe targeting either the Cre gene for the cassette AtRps5aproCre or the ZsGreen gene for the cassette AtUbq3prolox and using DIG Easy HybTM as hybridization buffer following the Roche DIG application manual for filter hybridization (Eisel et al. 2008 ). The probes were generated and labeled by PCR with primers p3769/p3770 and p3700/p3701 (Table S3) for Cre and ZsGreen, respectively using the Roche PCR DIG labeling mix following the manufacturer’s protocol. Detection was conducted using the chromogenic assay with NBT/BCIP according to the Roche DIG application manual for filter hybridization (Eisel et al. 2008 ). All chemicals used for making buffers, as well as blocking reagent (Cat# 11096176001), anti-DIG-AP (Cat# 11093274910), and NBT/BCIP (Cat# 11681451001), were from Millipore Sigma.
9
Replicon Plasmids and Electroporation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The replicon plasmids pLuc-HAV/18f and pLuc-HAV/18f-3DpolGDD→GAA (replication-defective mutant) were kindly provided by Stanley Lemon and were described previously (González-López et al., 2018 ). Plasmids were linearized using MluI-HF (New England BioLabs), RNA was generated using the MEGAscript T7 Kit (Invitrogen) and subsequently purified by lithium chloride precipitation. For electroporation, 1-2 million cells were washed three times in PBS, resuspended in 100 μL SF Nucleofector solution (Lonza), mixed with 250 ng replicon RNA per 80k cells, transferred to a 100 μL nucleocuvette and pulsed using the program FF-137 on an Amaxa 4D-Nucleofector X Unit (Lonza). Cells were then resuspended in equilibrated, antibiotic-free medium, distributed into 96-wells and lysed at different time points post-electroporation using 40 μL Passive Lysis buffer (Promega). Luminescence was measured using Luciferase Assay System (Promega) on a white-walled luminescence plate with an EnVision plate reader (PerkinElmer).
10
Quantifying Transduction Efficiency in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293Tsa cells48 (link) were transduced with 50, 5 and 0.5 µL of supernatant containing viral vectors. 72 h post-transduction, cells were harvested, and genomic DNA was isolated using the DNeasy Blood and Tissue kit (Qiagen). Approximately 50 ng of extracted genomic DNA was digested using MluI-HF (New England Biolabs). From the digestion mixture, 5 µL of digested genomic DNA was added to a PCR reaction mix containing 2 × ddPCR Supermix for Probes (no dUTP) (Bio-Rad), a primer/probe set for the RNaseP reference gene (TaqMan Copy Number Reference Assay, Applied Biosystems) and a primer/probe set for the target, which spans the SD1 and therefore specifically detects unspliced genomic RNA (TCTCGACGCAGGACTCG/CGCTCTCGCACCCATCTC (forward/reverse) and probe FAM-CTCCTTCTAGCCTCCGCTAG-BHQ1), at a final concentration of 0.9 μM of each primer and 0.25 μM of each probe. 20 µL of the final mix was added to a 96-well plate, and droplets were generated using the Automated Droplet Generator (Bio-Rad) following the manufacturer’s instructions. PCR was performed using the C1000 Touch Thermal Cycler (Bio-Rad) and droplets were read using a QX200 droplet reader. The average copy number per cell was used to calculate titre (TU/ml).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!