The salt-tolerant glutaminase gene sequence from M. luteus K-3 in the NCBI database (Accession number: DQ019448.1) was designed and synthesized according to the preference of B. subtilis (the codon optimization result is shown in Figure S1 in the Supplementary Materials ) by Sangon Biotech., Ltd. (Shanghai, China). PCR reagents, T4 DNA ligase, and restriction enzymes were purchased from TaKaRa (Dalian, China), and RNAiso Plus, the PrimeScript RT Reagent Kit and ChamQTMSYBR®qPCR Master Mix were purchased from Vazyme (Nanjing, China). Mini Plasmid Rapid Isolation and Mini DNA Rapid Purification Kits were purchased from Sangon Biotech (Shanghai, China). Experiments were performed in accordance with the manufacturer’s instructions.
Rnaiso plus
Manufactured by Vazyme
Sourced in China
RNAiso Plus is a total RNA isolation reagent developed by Vazyme. It is designed for the effective extraction and purification of total RNA from various biological samples, including animal tissues, cells, and microorganisms.
Automatically generated - may contain errors
Lab products found in correlation
Hiscript 3 qrt supermix, by Vazyme (3 mentions)
Chamq sybr qpcr master mix, by Vazyme (3 mentions)
Primescript rt reagent kit, by Vazyme (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Power sybr green pcr master mix, by Vazyme (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
T4 dna ligase, by Takara Bio (1 mentions)
Thermal cycler dice real time system, by Takara Bio (1 mentions)
Hiscript 2 q rt supermix, by Vazyme (1 mentions)
Sybr premix ex taq 2, by Vazyme (1 mentions)
7300 pcr system, by Thermo Fisher Scientific (1 mentions)
Hiscript 2 q rt supermix for qpcr gdna wiper, by Vazyme (1 mentions)
All in one mirna qrt pcr detection kit, by GeneCopoeia (1 mentions)
Prism 7500, by Thermo Fisher Scientific (1 mentions)
11 protocols using rnaiso plus
1
Heterologous Expression of Salt-Tolerant Glutaminase
2
Sensitive qRT-PCR gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the samples using RNAiso Plus (R401-01, Vazyme, China) and reversely transcribed to cDNA using the HiScipt III RT SuperMix for Quantitative Real-time PCR (+gDNA wiper) (R323-01, Vazyme, China). The quantitative reverse transcription PCR (qRT-PCR) was performed using ChamQ SYBR qRT-PCR Master Mix (Low ROX Premixed) (Q331-02, Vazyme, China) on an ABI QuantStudio5 System. GAPDH was used as the mRNAs endogenous control. All samples were normalized to the internal control, and the relative expression levels were calculated using the relative quantification assay. The primer sequences for qRT-PCR are shown in Additional file 1.
3
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAiso Plus (TRIzol; Vazyme Biotech) was used to extract total RNA from samples. HiScript II Q RT Super Mix (Vazyme Biotech) was applied for reverse transcription. Each experiment employed GAPDH as the internal control. Real‐time quantitative PCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech) in the Thermal Cycler Dice Real Time System (TP800, Takara). The RT‐qPCR data were evaluated with the 2−ΔΔCt method. In Additional file 1, the primers were listed: Table S1 .
4
Real-Time PCR Quantification of mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted using RNAiso plus (Vazyme Biotech Co. Ltd) according to the manufacturer's instructions. Real‐time polymerase chain reaction (PCR) with SYBR Green, which was validated with respect to reproducibility and linearity within the measuring range, was performed in triplicate with the Cycler System (Applied Biosystems, USA), and Power SYBR Green PCR Master Mix (Vazyme Biotech Co. Ltd) was used as a reagent. To correct for potential variances between samples in mRNA extraction or in reverse transcribed efficiency, the mRNA content of each gene was normalized to the expression of the stably expressed reference gene GAPDH within the same sample. Sequences for all PCR primers are described in Table . Amplifications were performed using thermal cycling conditions, including enzyme activation at 95 °C for 5 minutes, 40 cycles of denaturation at 95 °C for 10 seconds, and annealing/extension at 60 °C for 30 seconds. All samples were run in triplicate in 3 independent experiments. The relative expression level for each mRNA was calculated using the 2−ΔΔCt method.
5
Ovarian Gene Expression Analysis in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of ovaries of 3-week-old wt (n=5) and tg (n=5) female mice was extracted using RNAiso Plus reagent (Vazyme, Nanjing, China) and was synthesized to cDNA by reverse transcription PCR (RT-PCR) PrimeSript™ RT reagent Kit (Vazyme). Then, cDNA was used to detect the gene expression level by using qRT-PCR analysis as follows: 10 μL SYBR® Premix Ex Taq II (Vazyme), 1 μL cDNA, 10 μmol/L PCR Forward/Reverse Primer, and added RNase-free water to a total volume of 20 μL. Each sample was run in triplicate. The relative transcriptional level of the target gene was normalized to the 36B4 expression level using the method of 2−ΔΔCt (Livak and Schmittgen, 2001 (link)). The specific primers of the Pai gene used in this study were: forward: 5-tgacgagcgggaatacttta-3; reverse: 5-gagggtcatcagcccatcta-3. The specific primers of the 36B4 gene (housekeeping gene) used in this study were: forward: 5-cactggtctaggacccgagaag-3; reverse: 5-ggtgcctctggagattttcg-3.
6
Cardiac mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total mRNA was extracted from heart tissue using RNAiso plus (Vazyme Biotech Co. Ltd). Subsequently, a real-time polymerase chain reaction (PCR) was performed using Power SYBR Green PCR Master Mix (Vazyme Biotech Co. Ltd) on the Cycler System (Applied Biosystems, USA) according to the manufacturer’s instructions.
We normalized the mRNA content to GAPDH expression within a sample so as to eliminate potential differences in mRNA extraction between samples. Sequences for PCR primers were listed below: NLRP3(F:5′-CAACCTCACGTCACACTGCT-3′, R:5′-TTTCAGACAACCCCAGTTC-3′); ASC(F:5′-CTGACGGATGAGCAGTACCA-3′, R:5′-CAGGATGATTTGGTGGGATT-3′); GAPDH(F: 5′-ATGATTCTACCCACGGCAAG3-′, R: 5′-CTGGAAGATGGTGATGGGTT-3′) Caspase-1(F:5′-ACACGTCTTGCCCTCATTATCT-3′, R:5′-ATAACCTTGGGCTTGTCTTTCA-3′).AIM2(F:5′-TGCTGAATCTGACCAAAAGGT-3′, R:5′- TGTTCCAAGGGGCTGAGTT-3′).The relative level for each mRNA was analyzed using the 2-ΔΔCT method.
We normalized the mRNA content to GAPDH expression within a sample so as to eliminate potential differences in mRNA extraction between samples. Sequences for PCR primers were listed below: NLRP3(F:5′-CAACCTCACGTCACACTGCT-3′, R:5′-TTTCAGACAACCCCAGTTC-3′); ASC(F:5′-CTGACGGATGAGCAGTACCA-3′, R:5′-CAGGATGATTTGGTGGGATT-3′); GAPDH(F: 5′-ATGATTCTACCCACGGCAAG3-′, R: 5′-CTGGAAGATGGTGATGGGTT-3′) Caspase-1(F:5′-ACACGTCTTGCCCTCATTATCT-3′, R:5′-ATAACCTTGGGCTTGTCTTTCA-3′).AIM2(F:5′-TGCTGAATCTGACCAAAAGGT-3′, R:5′- TGTTCCAAGGGGCTGAGTT-3′).The relative level for each mRNA was analyzed using the 2-ΔΔCT method.
7
Quantitative RNA Analysis of Mouse Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from mouse kidney samples and Raw264.7 cell lysate using RNAiso Plus (Vazyme, Nanjing, China) following the manufacturer’s protocols. Subsequent reverse transcription and quantitative real-time PCR were performed using 5× HiScript III qRT SuperMix and 2× ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China). The expression levels of β-actin were used for data normalization, and the primers utilized in RT-qPCR were listed in Supplementary Table S3
8
Quantitative RT-PCR Analysis of Kidney Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A quantitative RT-PCR was applied to test gene expression of kidney tissues and TECs. In Brief, RNAiso Plus (Vazyme, Nanjing, China) was used to extract total RNA from the samples. To obtain cDNA, total RNA was reverse transcribed using 5ˣ HiScript III qRT SuperMix (Vazyme). PCR was performed using 2ˣChamQ SYBR qPCR Master Mix (Vazyme) and 7300 PCR System (Applied Biosystems, Waltham, MA, USA). The sequences of all the primers for quantitative real-time PCR are listed in Table 1 . Relative expression of the target genes was normalized to β-actin levels.
Primers for quantitative real-time PCR
| Primer (Mouse) | Forward | Reverse |
|---|---|---|
| MCP-1 | CTTCTGGGCCTGCTGTTCA | CCAGCCTACTCATTGGGATCA |
| IL-1β | GGTAAGTGGTTGCCCATCAGA | GTCGCTCAGGGTCACAAGAAA |
| TNF-α | CATCTTCTCAAAATTCGAGTGACAA | TGGGAGTAGACAAGGTACAACCC |
| IL-6 | AAAGAGTTGTGCAATGGCAATTCT | AAGTGCATCATCGTTGTTCATACA |
| KIM-1 | TCAGAAGAGCAGTCGGTACAAC | TGTAGCTGTGGGCCTTGTAGT |
| HIF-1α | AGATTCTGTTTGTTGAAGGGAG | AGGTGGATATGTCTGGGTTGA |
| Rab27a | TTCCTGCTTCTGTTCGACCT | GCTTATGTTTGTCCCGTTGG |
| β-actin | GGGAAATCGTGCGTGAC | AGGCTGGAAAAGAGCCT |
9
Bovine Fibroblast RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured bovine fibroblasts using RNAiso Plus (Vazyme) according to the manufacturer’s instructions, and a Nanodrop (Thermo, Germany) was used to quantify the purity and concentration of the RNA. One microgram of cDNA from each sample was obtained using HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme). Real-time PCR was performed using ChamQ UnIversal SYBR qPCR Master Mix (Vazyme) from Roche (LghtCycler 480) (USA) following the manufacturer’s instructions, and the relative expression of the target gene was subsequently normalized to that of the housekeeping gene (Gapdh) using the 2 −△△C method. The primers used for qPCR are listed in Supplementary Table 2.
10
Renal Transcriptomic Analysis in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from the renal cortex of mice and cultured cells using RNAiso Plus (Vazyme, Nanjing, China), according to the manufacturer’s instructions. Reverse transcription and quantitative renal-time PCR were performed using 5× HiScript III qRT SuperMix and 2× ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China). All the data were normalized to GAPDH. All the primers for RT-PCR were listed in Table 2 . For quantitative analysis of miR-181a-5p, miR-125a-3p, miR-150-5p, miR-125b-2-3p, and miR-219c-3p, All-in-One™ miRNA qRT-PCR Detection Kit and primers from Genecopeia (Guang Zhou, China) were used.
Primers of quantitative RT-PCR.
| Primer | Forward | Reverse |
|---|---|---|
| Mouse MCP-1 | CTTCTGGGCCTGCTGTTCA | CCAGCCTACTCATTGGGATCA |
| Mouse IL-6 | AAAGAGTTGTGCAATGGCAATTCT | AAGTGCATCATCGTTGTTCATACA |
| Mouse TNF-α | CATCTTCTCAAAATTCGAGTGACAA | TGGGAGTAGACAAGGTACAACCC |
| Mouse IL-1β | TGCCACCTTTTGACAGTGATG | AAGGTCCACGGGAAAGACAC |
| Mouse GAPDH | GCATGGCCTTCCGTGTTC | GATGTCATCATACTTGGCAGGTTT |
| Mouse Mincle | ACCAAATCGCCTGCATCC | CACTTGGGAGTTTTTGAAGCATC |
| Mouse SAP130 | ACTACGCCCAGACCCTAACA | AGGAACAATACGGCGACATC |
| Mouse miR-219c-3p | CGAGAAUUGCGUUUGGACAAUC | |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!